Incidental Mutation 'R0988:Pdia2'
ID97435
Institutional Source Beutler Lab
Gene Symbol Pdia2
Ensembl Gene ENSMUSG00000024184
Gene Nameprotein disulfide isomerase associated 2
SynonymsPdipl, 1810041F13Rik, Pdip
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26195999-26199087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26198829 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 69 (F69L)
Ref Sequence ENSEMBL: ENSMUSP00000114080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000163421] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039113
AA Change: F69L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184
AA Change: F69L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074370
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120333
AA Change: F69L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184
AA Change: F69L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect unknown
Transcript: ENSMUST00000142410
AA Change: F60L
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184
AA Change: F60L

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect probably benign
Transcript: ENSMUST00000163421
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148134
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Meta Mutation Damage Score 0.7858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. The protein plays a role in the folding of nascent proteins in the endoplasmic reticulum by forming disulfide bonds through its thiol isomerase, oxidase, and reductase activity. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Pdia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pdia2 APN 17 26198116 missense probably damaging 0.98
IGL01019:Pdia2 APN 17 26198922 missense probably damaging 1.00
IGL02289:Pdia2 APN 17 26197890 missense possibly damaging 0.66
IGL02725:Pdia2 APN 17 26196532 missense probably benign 0.05
R0553:Pdia2 UTSW 17 26196243 missense probably damaging 0.98
R1624:Pdia2 UTSW 17 26196521 missense probably damaging 1.00
R1917:Pdia2 UTSW 17 26198105 missense possibly damaging 0.82
R3950:Pdia2 UTSW 17 26197616 critical splice donor site probably null
R4583:Pdia2 UTSW 17 26196502 missense probably damaging 1.00
R5455:Pdia2 UTSW 17 26197163 missense probably null 0.99
R6841:Pdia2 UTSW 17 26196604 splice site probably null
R6889:Pdia2 UTSW 17 26196970 nonsense probably null
R7312:Pdia2 UTSW 17 26197660 missense possibly damaging 0.72
R7743:Pdia2 UTSW 17 26198868 missense probably benign 0.00
R7897:Pdia2 UTSW 17 26198233 missense probably benign
R8518:Pdia2 UTSW 17 26198170 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGGTGCCAGATCCCAGACAAAG -3'
(R):5'- ATGGACAAGCAGCTTCTGCCAGTG -3'

Sequencing Primer
(F):5'- TTCTGAAGCCTACCAGTGAAG -3'
(R):5'- TGCCAGTGTTGCTGCTC -3'
Posted On2014-01-05