Mutagenetix > Incidental Mutations

Incidental Mutation 'R1117:Slc36a3'

97436

Institutional Source

Beutler Lab

Gene Symbol

Slc36a3

Ensembl Gene

ENSMUSG00000049491

Gene Name

solute carrier family 36 (proton/amino acid symporter), member 3

Synonyms

TRAMD2, tramdorin2, PAT3

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R1117 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

55124815-55151708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55146180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 100 (I100V)

Ref Sequence

ENSEMBL: ENSMUSP00000020502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020502] [ENSMUST00000069816] [ENSMUST00000128244]

AlphaFold

Q811P0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020502
AA Change: I100V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020502
Gene: ENSMUSG00000049491
AA Change: I100V

Domain	Start	End	E-Value	Type
low complexity region	19	44	N/A	INTRINSIC
Pfam:Aa_trans	50	459	7.2e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000069816

SMART Domains

Protein: ENSMUSP00000064960
Gene: ENSMUSG00000049491

Domain	Start	End	E-Value	Type
low complexity region	19	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128244

SMART Domains

Protein: ENSMUSP00000116073
Gene: ENSMUSG00000049491

Domain	Start	End	E-Value	Type
low complexity region	19	44	N/A	INTRINSIC
Pfam:Aa_trans	50	87	2.7e-7	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Slc36a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03104:Slc36a3	APN	11	55125120	missense	probably damaging	1.00
IGL03241:Slc36a3	APN	11	55125108	missense	possibly damaging	0.95
R0632:Slc36a3	UTSW	11	55125080	missense	probably damaging	1.00
R1549:Slc36a3	UTSW	11	55142770	missense	probably damaging	1.00
R3423:Slc36a3	UTSW	11	55142781	missense	probably benign	0.00
R3425:Slc36a3	UTSW	11	55142781	missense	probably benign	0.00
R3791:Slc36a3	UTSW	11	55125156	missense	possibly damaging	0.95
R3980:Slc36a3	UTSW	11	55135383	missense	probably benign
R4970:Slc36a3	UTSW	11	55148573	missense	probably damaging	1.00
R4973:Slc36a3	UTSW	11	55146804	splice site	probably benign
R4986:Slc36a3	UTSW	11	55146766	makesense	probably null
R5112:Slc36a3	UTSW	11	55148573	missense	probably damaging	1.00
R5399:Slc36a3	UTSW	11	55146180	missense	possibly damaging	0.78
R5534:Slc36a3	UTSW	11	55142769	missense	possibly damaging	0.83
R5580:Slc36a3	UTSW	11	55135453	missense	probably benign	0.14
R5682:Slc36a3	UTSW	11	55125663	missense	probably benign	0.00
R5779:Slc36a3	UTSW	11	55135268	nonsense	probably null
R5841:Slc36a3	UTSW	11	55125721	nonsense	probably null
R6228:Slc36a3	UTSW	11	55124951	missense	probably benign	0.01
R6483:Slc36a3	UTSW	11	55135263	missense	probably benign	0.01
R6908:Slc36a3	UTSW	11	55149886	intron	probably benign
R6927:Slc36a3	UTSW	11	55129693	missense	probably damaging	0.98
R7828:Slc36a3	UTSW	11	55151198	missense	probably benign	0.00
R7995:Slc36a3	UTSW	11	55129669	missense	probably benign	0.04
R8212:Slc36a3	UTSW	11	55125081	missense	probably damaging	1.00
R8238:Slc36a3	UTSW	11	55131607	missense	probably benign	0.05
R8239:Slc36a3	UTSW	11	55131607	missense	probably benign	0.05
R8329:Slc36a3	UTSW	11	55148583	missense	probably damaging	1.00
R8929:Slc36a3	UTSW	11	55137311	missense	probably damaging	1.00
R9034:Slc36a3	UTSW	11	55125689	missense	probably damaging	0.99
Z1177:Slc36a3	UTSW	11	55135452	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGACAGTTTCTGTCCAAGACTCCTCC -3'
(R):5'- GCCCCTCAGCAGTGACACTAAATAG -3'

Sequencing Primer
(F):5'- TTCTGTCCAAGACTCCTCCAAAATC -3'
(R):5'- tgcttgcttgcttgcttg -3'

Posted On

2014-01-05