Incidental Mutation 'R1117:Slc36a3'
ID 97436
Institutional Source Beutler Lab
Gene Symbol Slc36a3
Ensembl Gene ENSMUSG00000049491
Gene Name solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms TRAMD2, tramdorin2, PAT3
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1117 (G1)
Quality Score 221
Status Not validated
Chromosome 11
Chromosomal Location 55124815-55151708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55146180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000020502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020502] [ENSMUST00000069816] [ENSMUST00000128244]
AlphaFold Q811P0
Predicted Effect possibly damaging
Transcript: ENSMUST00000020502
AA Change: I100V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020502
Gene: ENSMUSG00000049491
AA Change: I100V

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 459 7.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069816
SMART Domains Protein: ENSMUSP00000064960
Gene: ENSMUSG00000049491

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128244
SMART Domains Protein: ENSMUSP00000116073
Gene: ENSMUSG00000049491

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 87 2.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Slc36a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03104:Slc36a3 APN 11 55125120 missense probably damaging 1.00
IGL03241:Slc36a3 APN 11 55125108 missense possibly damaging 0.95
R0632:Slc36a3 UTSW 11 55125080 missense probably damaging 1.00
R1549:Slc36a3 UTSW 11 55142770 missense probably damaging 1.00
R3423:Slc36a3 UTSW 11 55142781 missense probably benign 0.00
R3425:Slc36a3 UTSW 11 55142781 missense probably benign 0.00
R3791:Slc36a3 UTSW 11 55125156 missense possibly damaging 0.95
R3980:Slc36a3 UTSW 11 55135383 missense probably benign
R4970:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R4973:Slc36a3 UTSW 11 55146804 splice site probably benign
R4986:Slc36a3 UTSW 11 55146766 makesense probably null
R5112:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R5399:Slc36a3 UTSW 11 55146180 missense possibly damaging 0.78
R5534:Slc36a3 UTSW 11 55142769 missense possibly damaging 0.83
R5580:Slc36a3 UTSW 11 55135453 missense probably benign 0.14
R5682:Slc36a3 UTSW 11 55125663 missense probably benign 0.00
R5779:Slc36a3 UTSW 11 55135268 nonsense probably null
R5841:Slc36a3 UTSW 11 55125721 nonsense probably null
R6228:Slc36a3 UTSW 11 55124951 missense probably benign 0.01
R6483:Slc36a3 UTSW 11 55135263 missense probably benign 0.01
R6908:Slc36a3 UTSW 11 55149886 intron probably benign
R6927:Slc36a3 UTSW 11 55129693 missense probably damaging 0.98
R7828:Slc36a3 UTSW 11 55151198 missense probably benign 0.00
R7995:Slc36a3 UTSW 11 55129669 missense probably benign 0.04
R8212:Slc36a3 UTSW 11 55125081 missense probably damaging 1.00
R8238:Slc36a3 UTSW 11 55131607 missense probably benign 0.05
R8239:Slc36a3 UTSW 11 55131607 missense probably benign 0.05
R8329:Slc36a3 UTSW 11 55148583 missense probably damaging 1.00
R8929:Slc36a3 UTSW 11 55137311 missense probably damaging 1.00
R9034:Slc36a3 UTSW 11 55125689 missense probably damaging 0.99
Z1177:Slc36a3 UTSW 11 55135452 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACAGTTTCTGTCCAAGACTCCTCC -3'
(R):5'- GCCCCTCAGCAGTGACACTAAATAG -3'

Sequencing Primer
(F):5'- TTCTGTCCAAGACTCCTCCAAAATC -3'
(R):5'- tgcttgcttgcttgcttg -3'
Posted On 2014-01-05