Incidental Mutation 'R0988:Proc'
ID97437
Institutional Source Beutler Lab
Gene Symbol Proc
Ensembl Gene ENSMUSG00000024386
Gene Nameprotein C
SynonymsPC, inactivator of coagulation factors Va, VIII
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32123129-32139570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32133483 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 97 (D97G)
Ref Sequence ENSEMBL: ENSMUSP00000132226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171765]
Predicted Effect probably benign
Transcript: ENSMUST00000171765
AA Change: D97G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132226
Gene: ENSMUSG00000024386
AA Change: D97G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GLA 24 86 6.66e-30 SMART
EGF_CA 87 131 1.25e-6 SMART
EGF 138 175 3.62e-3 SMART
low complexity region 201 210 N/A INTRINSIC
Tryp_SPc 211 444 2.6e-82 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: This gene encodes the vitamin K-dependent protein C, which plays a vital role in the anticoagulation pathway. The encoded protein undergoes proteolytic processing including activation by thrombin-thrombomodulin complex to form the anticoagulant serine protease that degrades activated coagulation factors. A complete lack of the encoded protein in mice results in severe perinatal consumptive coagulopathy in the brain and liver, resulting in death within 24 hours after birth. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Inactivation of the locus results in death within 24 hours of birth due to consumptive coagulopathy. Thromboses and bleeding are observed in the brains and livers of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Proc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Proc APN 18 32123513 missense probably benign 0.05
IGL01071:Proc APN 18 32123717 missense probably damaging 1.00
IGL01287:Proc APN 18 32123820 splice site probably benign
IGL01298:Proc APN 18 32123552 missense probably benign 0.01
IGL01898:Proc APN 18 32133145 critical splice donor site probably null
IGL01977:Proc APN 18 32127419 missense probably benign 0.02
IGL02040:Proc APN 18 32134860 missense probably benign 0.07
IGL02724:Proc APN 18 32134872 missense probably damaging 1.00
IGL02852:Proc APN 18 32125155 missense probably damaging 1.00
IGL02901:Proc APN 18 32123625 missense possibly damaging 0.89
IGL03401:Proc APN 18 32123273 missense possibly damaging 0.96
R0110:Proc UTSW 18 32125118 missense probably benign 0.26
R0131:Proc UTSW 18 32135898 missense probably benign 0.01
R0510:Proc UTSW 18 32125118 missense probably benign 0.26
R1455:Proc UTSW 18 32123398 missense probably damaging 1.00
R1463:Proc UTSW 18 32133438 missense possibly damaging 0.69
R1546:Proc UTSW 18 32127410 missense probably damaging 1.00
R1711:Proc UTSW 18 32127406 missense probably benign 0.05
R3414:Proc UTSW 18 32123685 missense probably benign 0.00
R3911:Proc UTSW 18 32123705 missense probably damaging 1.00
R4276:Proc UTSW 18 32135914 missense probably benign 0.00
R4598:Proc UTSW 18 32123459 missense probably damaging 1.00
R4623:Proc UTSW 18 32127473 missense probably benign 0.32
R4758:Proc UTSW 18 32123810 missense probably damaging 0.97
R4941:Proc UTSW 18 32125113 missense possibly damaging 0.60
R5917:Proc UTSW 18 32127460 missense probably benign 0.07
R6349:Proc UTSW 18 32133433 missense probably benign 0.00
R6636:Proc UTSW 18 32123760 missense probably benign 0.00
R6735:Proc UTSW 18 32123648 missense probably benign 0.01
R7110:Proc UTSW 18 32133388 missense probably benign 0.30
R7310:Proc UTSW 18 32135899 missense probably benign 0.03
R7409:Proc UTSW 18 32127460 missense probably benign 0.03
R7597:Proc UTSW 18 32123636 missense probably damaging 1.00
R7598:Proc UTSW 18 32135876 missense probably benign 0.00
R7604:Proc UTSW 18 32134778 intron probably null
R7738:Proc UTSW 18 32127479 nonsense probably null
X0021:Proc UTSW 18 32123507 missense probably damaging 0.96
Z1176:Proc UTSW 18 32134979 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAGTGCAAGCAGCCGCCATTGTTC -3'
(R):5'- AGATGTTTGTCTGGAAGCCCTTCCC -3'

Sequencing Primer
(F):5'- AGTCCTGGAAGCGCAACTC -3'
(R):5'- TCCTAGACACCTCGTATTCAGGAG -3'
Posted On2014-01-05