Incidental Mutation 'R1117:Olfr311'
ID 97438
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Name olfactory receptor 311
Synonyms MOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 58839251-58844111 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58841815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 234 (K234E)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
AlphaFold Q5NC59
Predicted Effect possibly damaging
Transcript: ENSMUST00000071625
AA Change: K234E

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: K234E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214776
Predicted Effect possibly damaging
Transcript: ENSMUST00000216473
AA Change: K234E

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0620:Olfr311 UTSW 11 58841443 missense probably damaging 1.00
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0827:Olfr311 UTSW 11 58841771 missense probably damaging 1.00
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2857:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3765:Olfr311 UTSW 11 58841294 missense probably damaging 1.00
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
R7163:Olfr311 UTSW 11 58841186 missense probably benign 0.12
R7605:Olfr311 UTSW 11 58841500 missense probably benign 0.00
R8328:Olfr311 UTSW 11 58841634 missense probably benign 0.00
Z1186:Olfr311 UTSW 11 58841081 start gained probably benign
Z1186:Olfr311 UTSW 11 58841119 missense probably benign
Z1186:Olfr311 UTSW 11 58841206 missense probably benign
Z1186:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1186:Olfr311 UTSW 11 58841789 missense probably benign
Z1187:Olfr311 UTSW 11 58841081 start gained probably benign
Z1187:Olfr311 UTSW 11 58841119 missense probably benign
Z1187:Olfr311 UTSW 11 58841206 missense probably benign
Z1187:Olfr311 UTSW 11 58841258 missense probably benign
Z1187:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1187:Olfr311 UTSW 11 58841789 missense probably benign
Z1188:Olfr311 UTSW 11 58841081 start gained probably benign
Z1188:Olfr311 UTSW 11 58841119 missense probably benign
Z1188:Olfr311 UTSW 11 58841206 missense probably benign
Z1188:Olfr311 UTSW 11 58841258 missense probably benign
Z1188:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1188:Olfr311 UTSW 11 58841789 missense probably benign
Z1189:Olfr311 UTSW 11 58841081 start gained probably benign
Z1189:Olfr311 UTSW 11 58841119 missense probably benign
Z1189:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1189:Olfr311 UTSW 11 58841789 missense probably benign
Z1190:Olfr311 UTSW 11 58841081 start gained probably benign
Z1190:Olfr311 UTSW 11 58841119 missense probably benign
Z1190:Olfr311 UTSW 11 58841206 missense probably benign
Z1190:Olfr311 UTSW 11 58841258 missense probably benign
Z1190:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1190:Olfr311 UTSW 11 58841789 missense probably benign
Z1191:Olfr311 UTSW 11 58841081 start gained probably benign
Z1191:Olfr311 UTSW 11 58841119 missense probably benign
Z1191:Olfr311 UTSW 11 58841206 missense probably benign
Z1191:Olfr311 UTSW 11 58841258 missense probably benign
Z1191:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1191:Olfr311 UTSW 11 58841789 missense probably benign
Z1192:Olfr311 UTSW 11 58841081 start gained probably benign
Z1192:Olfr311 UTSW 11 58841119 missense probably benign
Z1192:Olfr311 UTSW 11 58841206 missense probably benign
Z1192:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1192:Olfr311 UTSW 11 58841789 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCACCAGTCATGAGACTGTCC -3'
(R):5'- TCAGAGCCACACACTGTAGGCTTC -3'

Sequencing Primer
(F):5'- AGTCATGAGACTGTCCTGCAC -3'
(R):5'- ACACACTGTAGGCTTCAATGTC -3'
Posted On 2014-01-05