Incidental Mutation 'R0988:Napg'
ID97439
Institutional Source Beutler Lab
Gene Symbol Napg
Ensembl Gene ENSMUSG00000024581
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms2400003O04Rik, SNARE
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location62977836-62999450 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 62983360 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025474] [ENSMUST00000150267]
Predicted Effect probably benign
Transcript: ENSMUST00000025474
SMART Domains Protein: ENSMUSP00000025474
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 261 1e-30 PFAM
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137849
Predicted Effect probably benign
Transcript: ENSMUST00000150267
SMART Domains Protein: ENSMUSP00000122681
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 195 6.7e-23 PFAM
low complexity region 204 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155440
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Napg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Napg APN 18 62986445 missense probably benign 0.21
IGL02728:Napg APN 18 62994304 splice site probably benign
IGL02742:Napg APN 18 62986248 missense probably damaging 0.99
R0276:Napg UTSW 18 62986963 missense probably damaging 1.00
R0277:Napg UTSW 18 62986963 missense probably damaging 1.00
R0323:Napg UTSW 18 62986963 missense probably damaging 1.00
R0325:Napg UTSW 18 62986963 missense probably damaging 1.00
R0751:Napg UTSW 18 62994338 missense probably benign 0.04
R1184:Napg UTSW 18 62994338 missense probably benign 0.04
R1387:Napg UTSW 18 62986212 missense possibly damaging 0.50
R1678:Napg UTSW 18 62984072 critical splice donor site probably null
R1779:Napg UTSW 18 62982691 missense probably benign 0.33
R4723:Napg UTSW 18 62992492 critical splice donor site probably null
R5848:Napg UTSW 18 62994369 missense possibly damaging 0.49
R5874:Napg UTSW 18 62978020 nonsense probably null
R5973:Napg UTSW 18 62994983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGCAGTTTAAAGTGCTGCACAGG -3'
(R):5'- AAGTGACTTCCAAGCCACCGATG -3'

Sequencing Primer
(F):5'- CTGCACAGGGTGGTTCAG -3'
(R):5'- AGCCACCGATGTTTTTACAAGC -3'
Posted On2014-01-05