Incidental Mutation 'R0988:Olfr1451'
ID97441
Institutional Source Beutler Lab
Gene Symbol Olfr1451
Ensembl Gene ENSMUSG00000046913
Gene Nameolfactory receptor 1451
SynonymsGA_x6K02T2RE5P-3328502-3329434, MOR202-1
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12995014-13000417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12999787 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 267 (D267G)
Ref Sequence ENSEMBL: ENSMUSP00000146874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063144] [ENSMUST00000207997]
Predicted Effect probably benign
Transcript: ENSMUST00000063144
AA Change: D267G

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049885
Gene: ENSMUSG00000046913
AA Change: D267G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 2.2e-5 PFAM
Pfam:7tm_1 39 289 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207997
AA Change: D267G

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.2425 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Olfr1451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1451 APN 19 12999319 missense probably damaging 1.00
IGL01301:Olfr1451 APN 19 12999417 missense probably damaging 0.99
IGL01369:Olfr1451 APN 19 12999761 missense possibly damaging 0.78
IGL02098:Olfr1451 APN 19 12999573 missense probably benign 0.00
IGL02106:Olfr1451 APN 19 12999565 missense possibly damaging 0.80
IGL02369:Olfr1451 APN 19 12999708 missense probably damaging 1.00
ANU18:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
R0316:Olfr1451 UTSW 19 12999402 missense probably damaging 1.00
R0926:Olfr1451 UTSW 19 12999190 missense probably damaging 1.00
R1268:Olfr1451 UTSW 19 12999261 missense possibly damaging 0.80
R1509:Olfr1451 UTSW 19 12999451 missense possibly damaging 0.54
R1991:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2103:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2132:Olfr1451 UTSW 19 12999038 missense probably benign 0.21
R2206:Olfr1451 UTSW 19 12999040 missense probably benign 0.06
R3687:Olfr1451 UTSW 19 12999102 missense probably damaging 1.00
R4077:Olfr1451 UTSW 19 12999871 missense probably damaging 1.00
R4803:Olfr1451 UTSW 19 12999169 missense probably damaging 1.00
R4948:Olfr1451 UTSW 19 12999831 missense probably benign 0.06
R4999:Olfr1451 UTSW 19 12999219 missense probably benign 0.03
R6274:Olfr1451 UTSW 19 12999870 missense probably damaging 0.97
R6843:Olfr1451 UTSW 19 12998998 missense probably benign 0.09
R6928:Olfr1451 UTSW 19 12999838 missense probably damaging 0.99
R6941:Olfr1451 UTSW 19 12999497 missense possibly damaging 0.86
R7485:Olfr1451 UTSW 19 12999558 missense probably benign 0.03
R7611:Olfr1451 UTSW 19 12999067 missense possibly damaging 0.93
R7823:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGTTCCAGCAGTCTTGGCTC -3'
(R):5'- AGGCAGGAATCCCTGTGTATTGTAGAG -3'

Sequencing Primer
(F):5'- GCTCTGATATACACCTCAGTGAAG -3'
(R):5'- TCTAACTAATGCACAAAGAATATGGG -3'
Posted On2014-01-05