Incidental Mutation 'R1117:Gm4076'
ID 97443
Institutional Source Beutler Lab
Gene Symbol Gm4076
Ensembl Gene ENSMUSG00000096449
Gene Name predicted gene 4076
Synonyms
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 85126999-85127514 bp(-) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) A to G at 85127318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179230
SMART Domains Protein: ENSMUSP00000137467
Gene: ENSMUSG00000096449

DomainStartEndE-ValueType
Pfam:Proton_antipo_M 1 171 2.9e-47 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Gm4076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03102:Gm4076 APN 13 85127319 exon noncoding transcript
R0499:Gm4076 UTSW 13 85127226 exon noncoding transcript
R0879:Gm4076 UTSW 13 85127207 exon noncoding transcript
R1027:Gm4076 UTSW 13 85127389 exon noncoding transcript
R1892:Gm4076 UTSW 13 85127328 exon noncoding transcript
R2880:Gm4076 UTSW 13 85127238 exon noncoding transcript
R3551:Gm4076 UTSW 13 85127150 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCTGCAAAGATGCTTCCGAATGC -3'
(R):5'- AGAAGGCCCTACACCAGTTTCAGC -3'

Sequencing Primer
(F):5'- CTTCCGATTACTAGGCATGATGAG -3'
(R):5'- GCGCTACTACACTCAAGTACAATAG -3'
Posted On 2014-01-05