Mutagenetix > Incidental Mutations

Incidental Mutation 'R1117:Kcnj15'

97456

Institutional Source

Beutler Lab

Gene Symbol

Kcnj15

Ensembl Gene

ENSMUSG00000062609

Gene Name

potassium inwardly-rectifying channel, subfamily J, member 15

Synonyms

Kir4.2, IRKK, 4930414N08Rik

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95257558-95300260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 95295625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 8 (M8I)

Ref Sequence

ENSEMBL: ENSMUSP00000114646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037154] [ENSMUST00000113854] [ENSMUST00000113855] [ENSMUST00000113856] [ENSMUST00000113858] [ENSMUST00000113859] [ENSMUST00000113861] [ENSMUST00000113862] [ENSMUST00000125847] [ENSMUST00000134166] [ENSMUST00000138329] [ENSMUST00000140222] [ENSMUST00000152516]

AlphaFold

O88932

Predicted Effect

probably benign
Transcript: ENSMUST00000037154
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000045218
Gene: ENSMUSG00000062609
AA Change: M35I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	384	4.4e-139	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113854
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109485
Gene: ENSMUSG00000062609
AA Change: M8I

Domain	Start	End	E-Value	Type
Pfam:IRK	30	365	2.5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113855
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109486
Gene: ENSMUSG00000062609
AA Change: M8I

Domain	Start	End	E-Value	Type
Pfam:IRK	30	365	2.5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113856
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109487
Gene: ENSMUSG00000062609
AA Change: M8I

Domain	Start	End	E-Value	Type
Pfam:IRK	30	365	2.5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113858
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109489
Gene: ENSMUSG00000062609
AA Change: M8I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	392	4.9e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113859
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000109490
Gene: ENSMUSG00000062609
AA Change: M35I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	392	4.9e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113861
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000109492
Gene: ENSMUSG00000062609
AA Change: M35I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	392	4.9e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113862
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000109493
Gene: ENSMUSG00000062609
AA Change: M35I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	392	4.9e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125847
AA Change: M8I

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000134166
AA Change: M35I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118992
Gene: ENSMUSG00000062609
AA Change: M35I

Domain	Start	End	E-Value	Type
Pfam:IRK	57	173	8.9e-57	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138329

Predicted Effect

probably benign
Transcript: ENSMUST00000140222
AA Change: M35I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000152516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232622

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous knockout mice exhibited impaired balance/coordination in a high-throughput screen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Kcnj15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00733:Kcnj15	APN	16	95296463	missense	probably damaging	1.00
IGL03096:Kcnj15	APN	16	95296434	missense	probably damaging	1.00
R3911:Kcnj15	UTSW	16	95296470	missense	probably damaging	1.00
R3913:Kcnj15	UTSW	16	95296470	missense	probably damaging	1.00
R3928:Kcnj15	UTSW	16	95296509	missense	possibly damaging	0.95
R4155:Kcnj15	UTSW	16	95296307	nonsense	probably null
R4613:Kcnj15	UTSW	16	95295794	missense	probably damaging	1.00
R5334:Kcnj15	UTSW	16	95296649	missense	probably damaging	1.00
R6151:Kcnj15	UTSW	16	95295668	nonsense	probably null
R6334:Kcnj15	UTSW	16	95296236	missense	probably damaging	1.00
R6446:Kcnj15	UTSW	16	95296259	missense	probably benign	0.00
R6727:Kcnj15	UTSW	16	95296334	missense	probably damaging	1.00
R7070:Kcnj15	UTSW	16	95295831	missense	probably damaging	1.00
R8348:Kcnj15	UTSW	16	95295750	missense	probably damaging	1.00
R8937:Kcnj15	UTSW	16	95296689	unclassified	probably benign
R9018:Kcnj15	UTSW	16	95296270	missense	probably damaging	1.00
R9167:Kcnj15	UTSW	16	95295882	missense	probably damaging	1.00
R9171:Kcnj15	UTSW	16	95296622	missense	probably benign
R9371:Kcnj15	UTSW	16	95296697	missense	unknown
Z1088:Kcnj15	UTSW	16	95296119	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- actaacTGAAAGGCACCAAGAGATCAC -3'
(R):5'- AGCCAGAAAGGTCCCCGTAATGAA -3'

Sequencing Primer
(F):5'- AGTCTTATGGCACAGGGCAA -3'
(R):5'- GAGTCCACTTTCATAATGCAGGG -3'

Posted On

2014-01-05