Incidental Mutation 'R1117:Kcnj15'
ID97456
Institutional Source Beutler Lab
Gene Symbol Kcnj15
Ensembl Gene ENSMUSG00000062609
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 15
SynonymsKir4.2, IRKK, 4930414N08Rik
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95257558-95300260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95295625 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 8 (M8I)
Ref Sequence ENSEMBL: ENSMUSP00000114646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037154] [ENSMUST00000113854] [ENSMUST00000113855] [ENSMUST00000113856] [ENSMUST00000113858] [ENSMUST00000113859] [ENSMUST00000113861] [ENSMUST00000113862] [ENSMUST00000125847] [ENSMUST00000134166] [ENSMUST00000138329] [ENSMUST00000140222] [ENSMUST00000152516]
Predicted Effect probably benign
Transcript: ENSMUST00000037154
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045218
Gene: ENSMUSG00000062609
AA Change: M35I

DomainStartEndE-ValueType
Pfam:IRK 57 384 4.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113854
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109485
Gene: ENSMUSG00000062609
AA Change: M8I

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113855
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109486
Gene: ENSMUSG00000062609
AA Change: M8I

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113856
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109487
Gene: ENSMUSG00000062609
AA Change: M8I

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113858
AA Change: M8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109489
Gene: ENSMUSG00000062609
AA Change: M8I

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113859
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109490
Gene: ENSMUSG00000062609
AA Change: M35I

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113861
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109492
Gene: ENSMUSG00000062609
AA Change: M35I

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113862
AA Change: M35I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109493
Gene: ENSMUSG00000062609
AA Change: M35I

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125847
AA Change: M8I

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000134166
AA Change: M35I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118992
Gene: ENSMUSG00000062609
AA Change: M35I

DomainStartEndE-ValueType
Pfam:IRK 57 173 8.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138329
Predicted Effect probably benign
Transcript: ENSMUST00000140222
AA Change: M35I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000152516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232622
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous knockout mice exhibited impaired balance/coordination in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Kcnj15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Kcnj15 APN 16 95296463 missense probably damaging 1.00
IGL03096:Kcnj15 APN 16 95296434 missense probably damaging 1.00
R3911:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3913:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3928:Kcnj15 UTSW 16 95296509 missense possibly damaging 0.95
R4155:Kcnj15 UTSW 16 95296307 nonsense probably null
R4613:Kcnj15 UTSW 16 95295794 missense probably damaging 1.00
R5334:Kcnj15 UTSW 16 95296649 missense probably damaging 1.00
R6151:Kcnj15 UTSW 16 95295668 nonsense probably null
R6334:Kcnj15 UTSW 16 95296236 missense probably damaging 1.00
R6446:Kcnj15 UTSW 16 95296259 missense probably benign 0.00
R6727:Kcnj15 UTSW 16 95296334 missense probably damaging 1.00
R7070:Kcnj15 UTSW 16 95295831 missense probably damaging 1.00
Z1088:Kcnj15 UTSW 16 95296119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- actaacTGAAAGGCACCAAGAGATCAC -3'
(R):5'- AGCCAGAAAGGTCCCCGTAATGAA -3'

Sequencing Primer
(F):5'- AGTCTTATGGCACAGGGCAA -3'
(R):5'- GAGTCCACTTTCATAATGCAGGG -3'
Posted On2014-01-05