Incidental Mutation 'R1117:Olfr63'
ID97458
Institutional Source Beutler Lab
Gene Symbol Olfr63
Ensembl Gene ENSMUSG00000054666
Gene Nameolfactory receptor 63
SynonymsGA_x6K02T2NTC5-9778-8828, M4, MOR267-1
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33264676-33275644 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 33268966 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 81 (R81*)
Ref Sequence ENSEMBL: ENSMUSP00000150323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067840] [ENSMUST00000217023]
Predicted Effect probably null
Transcript: ENSMUST00000067840
AA Change: R81*
SMART Domains Protein: ENSMUSP00000067207
Gene: ENSMUSG00000054666
AA Change: R81*

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7tm_1 42 288 5.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215466
Predicted Effect probably null
Transcript: ENSMUST00000217023
AA Change: R81*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Olfr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr63 APN 17 33269655 missense probably benign 0.00
IGL02313:Olfr63 APN 17 33269665 missense probably benign
IGL02639:Olfr63 APN 17 33269395 missense possibly damaging 0.96
IGL02851:Olfr63 APN 17 33269354 missense probably benign 0.01
IGL03007:Olfr63 APN 17 33268883 missense probably damaging 0.98
IGL03206:Olfr63 APN 17 33268751 missense possibly damaging 0.46
R0143:Olfr63 UTSW 17 33269497 missense probably damaging 1.00
R0355:Olfr63 UTSW 17 33269135 missense probably damaging 0.98
R1115:Olfr63 UTSW 17 33268966 nonsense probably null
R1567:Olfr63 UTSW 17 33269476 missense probably benign
R1986:Olfr63 UTSW 17 33269515 missense probably benign 0.00
R3905:Olfr63 UTSW 17 33268775 missense probably damaging 1.00
R4612:Olfr63 UTSW 17 33269480 missense probably benign 0.20
R5650:Olfr63 UTSW 17 33268884 missense probably benign 0.05
R5855:Olfr63 UTSW 17 33269336 missense possibly damaging 0.81
R6712:Olfr63 UTSW 17 33269268 missense possibly damaging 0.76
R7873:Olfr63 UTSW 17 33269374 missense probably benign
X0026:Olfr63 UTSW 17 33269050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATCTCATCAGCCTCAGGAGC -3'
(R):5'- TCTCAAGATGGCGGCCACAATAAAG -3'

Sequencing Primer
(F):5'- TGCCCGGTCAGAACTACAG -3'
(R):5'- AGTGACAAAGGCTGTCCTTTC -3'
Posted On2014-01-05