Mutagenetix > Incidental Mutation

Incidental Mutation 'R1117:Tcerg1'

97464

Institutional Source

Beutler Lab

Gene Symbol

Tcerg1

Ensembl Gene

ENSMUSG00000024498

Gene Name

transcription elongation regulator 1 (CA150)

Synonyms

Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150

MMRRC Submission

039190-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42511510-42575551 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42574652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1079 (D1079G)

Ref Sequence

ENSEMBL: ENSMUSP00000025375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000054738] [ENSMUST00000173642]

AlphaFold

Q8CGF7

PDB Structure

FBP28WW DOMAIN FROM MUS MUSCULUS [SOLUTION NMR]
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Solution structure of the first WW domain from the mouse transcription elongation regulator 1, transcription factor CA150 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025375
AA Change: D1079G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: D1079G

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
low complexity region	40	92	N/A	INTRINSIC
WW	132	164	8.27e-10	SMART
low complexity region	178	257	N/A	INTRINSIC
low complexity region	260	347	N/A	INTRINSIC
low complexity region	350	373	N/A	INTRINSIC
WW	432	464	2.65e-8	SMART
WW	531	563	1.2e-6	SMART
low complexity region	611	623	N/A	INTRINSIC
coiled coil region	629	654	N/A	INTRINSIC
FF	661	714	2.67e-13	SMART
FF	727	781	1.51e-12	SMART
FF	794	848	4.29e-17	SMART
FF	898	954	8.33e-15	SMART
FF	956	1012	1.47e-15	SMART
FF	1014	1079	1.3e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000054738

SMART Domains

Protein: ENSMUSP00000058887
Gene: ENSMUSG00000042816

Domain	Start	End	E-Value	Type
Pfam:7tm_1	57	310	1.6e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173642

SMART Domains

Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
low complexity region	40	92	N/A	INTRINSIC
WW	132	164	8.27e-10	SMART
low complexity region	178	257	N/A	INTRINSIC
low complexity region	260	347	N/A	INTRINSIC
low complexity region	350	373	N/A	INTRINSIC
WW	432	464	2.65e-8	SMART
WW	531	563	1.2e-6	SMART
low complexity region	611	623	N/A	INTRINSIC
coiled coil region	629	654	N/A	INTRINSIC
FF	661	714	2.67e-13	SMART
FF	727	781	1.51e-12	SMART
FF	794	848	4.29e-17	SMART
FF	898	954	8.33e-15	SMART
FF	956	1012	1.47e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184771

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Tcerg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00701:Tcerg1	APN	18	42536342	missense	probably benign	0.34
IGL00708:Tcerg1	APN	18	42571125	missense	probably benign	0.38
IGL00741:Tcerg1	APN	18	42568453	missense	possibly damaging	0.94
IGL01314:Tcerg1	APN	18	42573309	missense	probably damaging	1.00
IGL01358:Tcerg1	APN	18	42524277	missense	unknown
IGL01832:Tcerg1	APN	18	42574555	missense	probably damaging	0.99
IGL01985:Tcerg1	APN	18	42530656	missense	unknown
IGL02937:Tcerg1	APN	18	42524349	missense	unknown
IGL02953:Tcerg1	APN	18	42548470	missense	probably damaging	1.00
IGL03082:Tcerg1	APN	18	42573357	missense	probably damaging	1.00
P0031:Tcerg1	UTSW	18	42573302	missense	probably benign	0.07
R0060:Tcerg1	UTSW	18	42524008	missense	unknown
R0138:Tcerg1	UTSW	18	42568614	splice site	probably benign
R0482:Tcerg1	UTSW	18	42564240	splice site	probably benign
R0502:Tcerg1	UTSW	18	42522956	missense	unknown
R0731:Tcerg1	UTSW	18	42571840	missense	probably damaging	0.99
R1542:Tcerg1	UTSW	18	42553430	missense	probably damaging	0.99
R1571:Tcerg1	UTSW	18	42524292	missense	unknown
R1673:Tcerg1	UTSW	18	42552581	missense	possibly damaging	0.91
R1678:Tcerg1	UTSW	18	42524349	missense	unknown
R1799:Tcerg1	UTSW	18	42560947	missense	possibly damaging	0.92
R2094:Tcerg1	UTSW	18	42564145	missense	possibly damaging	0.92
R2231:Tcerg1	UTSW	18	42524244	missense	unknown
R2989:Tcerg1	UTSW	18	42519475	missense	unknown
R3831:Tcerg1	UTSW	18	42568489	missense	probably damaging	1.00
R4009:Tcerg1	UTSW	18	42564136	frame shift	probably null
R4034:Tcerg1	UTSW	18	42519533	missense	unknown
R4826:Tcerg1	UTSW	18	42535115	missense	unknown
R4858:Tcerg1	UTSW	18	42523981	missense	unknown
R5371:Tcerg1	UTSW	18	42519535	missense	unknown
R5865:Tcerg1	UTSW	18	42536348	missense	probably damaging	0.98
R6128:Tcerg1	UTSW	18	42511498	splice site	probably null
R6258:Tcerg1	UTSW	18	42553465	missense	probably damaging	1.00
R6260:Tcerg1	UTSW	18	42553465	missense	probably damaging	1.00
R6516:Tcerg1	UTSW	18	42530892	critical splice donor site	probably null
R6825:Tcerg1	UTSW	18	42548477	missense	probably damaging	0.98
R7147:Tcerg1	UTSW	18	42550063	missense	probably benign	0.22
R7714:Tcerg1	UTSW	18	42560935	missense	possibly damaging	0.77
R7739:Tcerg1	UTSW	18	42523974	missense	unknown
R7838:Tcerg1	UTSW	18	42536937	missense	probably benign	0.01
R8204:Tcerg1	UTSW	18	42574553	missense	probably damaging	1.00
R8293:Tcerg1	UTSW	18	42560955	missense	probably benign	0.03
R8300:Tcerg1	UTSW	18	42550072	missense	probably benign	0.22
R8426:Tcerg1	UTSW	18	42548401	missense	possibly damaging	0.68
R8514:Tcerg1	UTSW	18	42564122	missense	probably damaging	0.98
R8672:Tcerg1	UTSW	18	42553494	missense	probably damaging	1.00
R9367:Tcerg1	UTSW	18	42552508	missense	possibly damaging	0.93
R9715:Tcerg1	UTSW	18	42573348	missense	probably damaging	0.99
R9718:Tcerg1	UTSW	18	42530771	missense	unknown
R9781:Tcerg1	UTSW	18	42567965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATAGTGCTGAGGGTGTGCTTCATAG -3'
(R):5'- TCGTCAGGTGATTTTGCAATAGGTTGA -3'

Sequencing Primer
(F):5'- cagtaggggtgggaggg -3'
(R):5'- GATTTTGCAATAGGTTGACTAATGC -3'

Posted On

2014-01-05