Incidental Mutation 'R0989:Extl1'
ID97471
Institutional Source Beutler Lab
Gene Symbol Extl1
Ensembl Gene ENSMUSG00000028838
Gene Nameexostoses (multiple)-like 1
SynonymsD430033M16Rik
MMRRC Submission 039109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R0989 (G1)
Quality Score196
Status Not validated
Chromosome4
Chromosomal Location134356372-134383850 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCGTTGCACCGATACCGGG to TG at 134357677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030643] [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105874]
Predicted Effect probably benign
Transcript: ENSMUST00000030643
SMART Domains Protein: ENSMUSP00000030643
Gene: ENSMUSG00000028838

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Exostosin 87 329 2.1e-38 PFAM
Pfam:Glyco_transf_64 412 652 1.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081094
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105872
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105874
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
C4bp G A 1: 130,643,053 T262I probably benign Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Crim1 T C 17: 78,200,944 V59A probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxw11 T C 11: 32,735,149 V328A probably benign Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr552 G A 7: 102,604,483 G43D probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pcolce2 T A 9: 95,638,723 M51K probably benign Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in Extl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Extl1 APN 4 134358019 missense probably damaging 1.00
IGL01404:Extl1 APN 4 134359203 missense probably benign 0.06
IGL03040:Extl1 APN 4 134360629 splice site probably benign
R0165:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R0566:Extl1 UTSW 4 134357677 unclassified probably benign
R0575:Extl1 UTSW 4 134357677 unclassified probably benign
R0941:Extl1 UTSW 4 134357677 unclassified probably benign
R0943:Extl1 UTSW 4 134357677 unclassified probably benign
R0988:Extl1 UTSW 4 134357677 unclassified probably benign
R0990:Extl1 UTSW 4 134357677 unclassified probably benign
R1022:Extl1 UTSW 4 134357677 unclassified probably benign
R1035:Extl1 UTSW 4 134357677 unclassified probably benign
R1344:Extl1 UTSW 4 134359241 missense probably damaging 0.99
R1495:Extl1 UTSW 4 134357677 unclassified probably benign
R1699:Extl1 UTSW 4 134364583 nonsense probably null
R1750:Extl1 UTSW 4 134362688 missense probably benign 0.00
R1768:Extl1 UTSW 4 134371138 missense probably benign
R1883:Extl1 UTSW 4 134364606 missense probably benign 0.01
R2143:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2144:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2155:Extl1 UTSW 4 134363180 missense possibly damaging 0.71
R4298:Extl1 UTSW 4 134357658 missense probably damaging 1.00
R4605:Extl1 UTSW 4 134359834 missense probably benign 0.00
R4606:Extl1 UTSW 4 134371379 missense probably damaging 0.99
R4606:Extl1 UTSW 4 134371380 missense probably benign 0.00
R4787:Extl1 UTSW 4 134364667 missense probably damaging 1.00
R5210:Extl1 UTSW 4 134360584 missense probably benign 0.02
R5776:Extl1 UTSW 4 134357772 missense possibly damaging 0.82
R6216:Extl1 UTSW 4 134363130 missense probably benign
R6392:Extl1 UTSW 4 134364634 missense probably benign 0.44
R6674:Extl1 UTSW 4 134358127 missense probably damaging 0.97
R7218:Extl1 UTSW 4 134359769 missense probably benign 0.14
R7779:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R7779:Extl1 UTSW 4 134360597 missense probably benign 0.25
R7795:Extl1 UTSW 4 134364679 missense probably damaging 1.00
R7800:Extl1 UTSW 4 134371618 missense probably benign 0.10
X0020:Extl1 UTSW 4 134358021 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGTGCGAAACGTGCCAAACG -3'
(R):5'- ATGAACTTCCTGGTAGCCACCGTC -3'

Sequencing Primer
(F):5'- CGTGCCAAACGCAACCC -3'
(R):5'- ACTGCCCCCTATCAAGGTG -3'
Posted On2014-01-05