Incidental Mutation 'R0989:Dnah10'
ID 97476
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Name dynein, axonemal, heavy chain 10
Synonyms Dnahc10
MMRRC Submission 039109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0989 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124802149-124911372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124875002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2560 (I2560V)
Ref Sequence ENSEMBL: ENSMUSP00000062995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: I2560V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: I2560V

low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126998
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: I2503V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: I2503V

low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197824
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,030,273 (GRCm39) D140G probably damaging Het
Atp7b A G 8: 22,518,710 (GRCm39) S43P possibly damaging Het
C4bp G A 1: 130,570,790 (GRCm39) T262I probably benign Het
Cdh23 A G 10: 60,370,289 (GRCm39) Y169H probably damaging Het
Celsr1 T C 15: 85,915,480 (GRCm39) E831G probably benign Het
Celsr2 A C 3: 108,310,588 (GRCm39) M1498R probably benign Het
Crim1 T C 17: 78,508,373 (GRCm39) V59A probably benign Het
Enpp2 A T 15: 54,739,155 (GRCm39) M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fam120a G T 13: 49,039,219 (GRCm39) A979E possibly damaging Het
Fbxw11 T C 11: 32,685,149 (GRCm39) V328A probably benign Het
Gm4846 G A 1: 166,314,689 (GRCm39) S318L possibly damaging Het
Golm1 A T 13: 59,787,997 (GRCm39) Y301N probably benign Het
Ipo8 T C 6: 148,698,180 (GRCm39) T614A probably benign Het
Klhl33 T A 14: 51,129,279 (GRCm39) Y390F probably damaging Het
Minar1 T A 9: 89,484,088 (GRCm39) K436N probably damaging Het
Mlh3 A G 12: 85,316,169 (GRCm39) S6P probably benign Het
Neurod2 A G 11: 98,218,805 (GRCm39) S120P probably damaging Het
Nfkb1 A G 3: 135,295,157 (GRCm39) S896P probably benign Het
Nr3c2 T C 8: 77,914,193 (GRCm39) Y687H probably damaging Het
Or13a24 A C 7: 140,154,200 (GRCm39) I45L probably damaging Het
Or52k2 G A 7: 102,253,690 (GRCm39) G43D probably damaging Het
Parp3 C T 9: 106,350,281 (GRCm39) probably null Het
Pcolce2 T A 9: 95,520,776 (GRCm39) M51K probably benign Het
Pnoc T C 14: 65,642,317 (GRCm39) K149E probably damaging Het
Polr1b T G 2: 128,967,997 (GRCm39) V1130G probably damaging Het
Prcp A T 7: 92,559,424 (GRCm39) I163F probably benign Het
Sez6l2 A G 7: 126,559,016 (GRCm39) D361G probably damaging Het
Slc4a9 T A 18: 36,669,920 (GRCm39) L785* probably null Het
Ssna1 T C 2: 25,161,575 (GRCm39) T91A probably benign Het
St18 A G 1: 6,898,105 (GRCm39) T636A probably benign Het
Tln2 C T 9: 67,136,736 (GRCm39) A1250T probably damaging Het
Tnk2 A G 16: 32,499,176 (GRCm39) M815V probably damaging Het
Tspan31 T A 10: 126,904,196 (GRCm39) H167L probably damaging Het
Tspoap1 T A 11: 87,656,649 (GRCm39) C287S probably damaging Het
Unc80 T C 1: 66,685,599 (GRCm39) F2241S possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124,905,667 (GRCm39) missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124,823,680 (GRCm39) missense probably benign 0.01
IGL00471:Dnah10 APN 5 124,871,405 (GRCm39) missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124,852,576 (GRCm39) missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124,854,276 (GRCm39) missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124,856,218 (GRCm39) missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124,861,010 (GRCm39) missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124,898,405 (GRCm39) missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124,809,553 (GRCm39) missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124,880,392 (GRCm39) missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124,864,529 (GRCm39) missense probably benign 0.10
IGL01757:Dnah10 APN 5 124,845,991 (GRCm39) missense probably benign 0.37
IGL01759:Dnah10 APN 5 124,832,850 (GRCm39) missense probably benign
IGL01767:Dnah10 APN 5 124,820,801 (GRCm39) splice site probably benign
IGL01769:Dnah10 APN 5 124,842,008 (GRCm39) missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124,860,985 (GRCm39) missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124,866,876 (GRCm39) missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124,881,810 (GRCm39) missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124,896,430 (GRCm39) missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124,910,487 (GRCm39) critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124,850,131 (GRCm39) missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124,850,883 (GRCm39) missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124,866,860 (GRCm39) missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124,870,916 (GRCm39) missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124,898,351 (GRCm39) missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124,864,395 (GRCm39) missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124,876,069 (GRCm39) missense probably benign 0.26
IGL02709:Dnah10 APN 5 124,850,809 (GRCm39) nonsense probably null
IGL02740:Dnah10 APN 5 124,903,927 (GRCm39) splice site probably benign
IGL02746:Dnah10 APN 5 124,807,150 (GRCm39) missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124,875,078 (GRCm39) missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124,878,886 (GRCm39) missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124,840,197 (GRCm39) missense probably benign 0.07
IGL03076:Dnah10 APN 5 124,807,226 (GRCm39) critical splice donor site probably null
IGL03109:Dnah10 APN 5 124,841,950 (GRCm39) missense probably benign 0.10
IGL03181:Dnah10 APN 5 124,825,521 (GRCm39) missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124,894,707 (GRCm39) missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124,894,761 (GRCm39) missense probably benign 0.00
IGL03328:Dnah10 APN 5 124,831,354 (GRCm39) missense probably benign 0.06
frosty UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124,906,593 (GRCm39) missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124,807,164 (GRCm39) missense probably benign
P0019:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
P0037:Dnah10 UTSW 5 124,895,056 (GRCm39) nonsense probably null
PIT4366001:Dnah10 UTSW 5 124,852,588 (GRCm39) missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124,803,966 (GRCm39) missense probably benign
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124,907,808 (GRCm39) missense probably benign 0.00
R0066:Dnah10 UTSW 5 124,840,140 (GRCm39) missense probably benign 0.01
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124,911,139 (GRCm39) missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124,873,433 (GRCm39) splice site probably benign
R0321:Dnah10 UTSW 5 124,900,416 (GRCm39) missense probably benign 0.29
R0410:Dnah10 UTSW 5 124,832,799 (GRCm39) missense probably benign
R0480:Dnah10 UTSW 5 124,885,915 (GRCm39) missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124,889,787 (GRCm39) critical splice donor site probably null
R0533:Dnah10 UTSW 5 124,852,314 (GRCm39) splice site probably null
R0599:Dnah10 UTSW 5 124,878,017 (GRCm39) missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124,827,876 (GRCm39) missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124,906,641 (GRCm39) missense probably damaging 0.99
R1203:Dnah10 UTSW 5 124,837,078 (GRCm39) splice site probably null
R1248:Dnah10 UTSW 5 124,832,887 (GRCm39) splice site probably benign
R1366:Dnah10 UTSW 5 124,830,390 (GRCm39) missense probably benign 0.41
R1434:Dnah10 UTSW 5 124,852,050 (GRCm39) missense probably benign 0.03
R1436:Dnah10 UTSW 5 124,839,285 (GRCm39) missense probably benign 0.00
R1438:Dnah10 UTSW 5 124,876,009 (GRCm39) missense probably benign 0.25
R1446:Dnah10 UTSW 5 124,866,860 (GRCm39) missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124,820,750 (GRCm39) missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1479:Dnah10 UTSW 5 124,854,953 (GRCm39) missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124,831,303 (GRCm39) missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124,838,016 (GRCm39) missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124,906,678 (GRCm39) missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124,842,626 (GRCm39) missense probably benign 0.00
R1709:Dnah10 UTSW 5 124,837,155 (GRCm39) missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124,850,254 (GRCm39) splice site probably null
R1828:Dnah10 UTSW 5 124,838,343 (GRCm39) missense probably benign 0.00
R1854:Dnah10 UTSW 5 124,881,753 (GRCm39) missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124,909,590 (GRCm39) splice site probably null
R1893:Dnah10 UTSW 5 124,831,381 (GRCm39) missense probably benign 0.13
R1895:Dnah10 UTSW 5 124,835,494 (GRCm39) missense probably benign 0.00
R1906:Dnah10 UTSW 5 124,878,048 (GRCm39) missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124,859,332 (GRCm39) missense probably benign 0.00
R1965:Dnah10 UTSW 5 124,852,267 (GRCm39) missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124,911,052 (GRCm39) missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124,906,651 (GRCm39) missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124,823,768 (GRCm39) missense probably benign 0.30
R2046:Dnah10 UTSW 5 124,873,405 (GRCm39) missense probably benign 0.25
R2074:Dnah10 UTSW 5 124,891,738 (GRCm39) missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124,852,045 (GRCm39) missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124,838,301 (GRCm39) missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124,808,530 (GRCm39) missense probably benign 0.00
R2293:Dnah10 UTSW 5 124,896,285 (GRCm39) missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124,819,064 (GRCm39) missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124,839,929 (GRCm39) critical splice donor site probably null
R2571:Dnah10 UTSW 5 124,852,542 (GRCm39) missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124,894,734 (GRCm39) missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124,896,476 (GRCm39) critical splice donor site probably null
R3439:Dnah10 UTSW 5 124,873,322 (GRCm39) missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124,824,694 (GRCm39) missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124,850,095 (GRCm39) missense probably benign 0.37
R4015:Dnah10 UTSW 5 124,854,990 (GRCm39) missense probably benign 0.25
R4261:Dnah10 UTSW 5 124,807,201 (GRCm39) missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124,809,394 (GRCm39) missense probably benign 0.28
R4299:Dnah10 UTSW 5 124,896,989 (GRCm39) missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124,839,933 (GRCm39) splice site probably null
R4651:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4652:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4664:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124,852,581 (GRCm39) missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124,824,809 (GRCm39) missense probably benign 0.01
R4806:Dnah10 UTSW 5 124,896,408 (GRCm39) missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124,850,196 (GRCm39) missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124,894,812 (GRCm39) missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124,839,260 (GRCm39) missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124,909,577 (GRCm39) missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5119:Dnah10 UTSW 5 124,856,322 (GRCm39) missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124,876,024 (GRCm39) missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124,864,484 (GRCm39) missense probably benign 0.00
R5262:Dnah10 UTSW 5 124,862,220 (GRCm39) missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124,868,851 (GRCm39) missense probably benign 0.01
R5322:Dnah10 UTSW 5 124,850,630 (GRCm39) missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124,820,693 (GRCm39) missense probably benign 0.16
R5468:Dnah10 UTSW 5 124,907,557 (GRCm39) missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124,830,232 (GRCm39) missense probably benign
R5587:Dnah10 UTSW 5 124,870,977 (GRCm39) missense probably benign 0.10
R5724:Dnah10 UTSW 5 124,819,090 (GRCm39) missense probably benign 0.27
R5797:Dnah10 UTSW 5 124,898,450 (GRCm39) missense probably benign 0.00
R5812:Dnah10 UTSW 5 124,824,810 (GRCm39) missense probably benign 0.01
R5846:Dnah10 UTSW 5 124,900,437 (GRCm39) missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R5961:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5970:Dnah10 UTSW 5 124,885,793 (GRCm39) missense probably benign
R6021:Dnah10 UTSW 5 124,814,048 (GRCm39) missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124,878,924 (GRCm39) missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124,896,274 (GRCm39) missense probably benign 0.09
R6080:Dnah10 UTSW 5 124,882,961 (GRCm39) missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124,830,238 (GRCm39) missense probably benign 0.18
R6155:Dnah10 UTSW 5 124,862,239 (GRCm39) missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124,847,663 (GRCm39) missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124,900,382 (GRCm39) missense probably benign 0.02
R6238:Dnah10 UTSW 5 124,820,743 (GRCm39) missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124,871,283 (GRCm39) splice site probably null
R6275:Dnah10 UTSW 5 124,862,248 (GRCm39) missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124,852,144 (GRCm39) missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124,906,710 (GRCm39) missense probably benign 0.00
R6458:Dnah10 UTSW 5 124,886,333 (GRCm39) missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124,839,846 (GRCm39) missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124,835,419 (GRCm39) missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124,907,097 (GRCm39) missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124,837,223 (GRCm39) missense probably benign 0.45
R6702:Dnah10 UTSW 5 124,882,869 (GRCm39) missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124,885,876 (GRCm39) missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124,854,890 (GRCm39) missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124,867,064 (GRCm39) splice site probably null
R6932:Dnah10 UTSW 5 124,898,514 (GRCm39) missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124,864,490 (GRCm39) missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124,893,206 (GRCm39) missense probably benign 0.37
R7138:Dnah10 UTSW 5 124,900,009 (GRCm39) missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124,900,006 (GRCm39) missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124,890,892 (GRCm39) missense probably benign 0.19
R7278:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R7284:Dnah10 UTSW 5 124,909,662 (GRCm39) missense probably benign 0.37
R7322:Dnah10 UTSW 5 124,898,333 (GRCm39) missense probably benign 0.08
R7523:Dnah10 UTSW 5 124,824,803 (GRCm39) missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124,876,095 (GRCm39) missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124,823,608 (GRCm39) missense probably benign 0.21
R7606:Dnah10 UTSW 5 124,894,776 (GRCm39) missense probably benign 0.00
R7835:Dnah10 UTSW 5 124,854,298 (GRCm39) missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124,859,425 (GRCm39) missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124,803,949 (GRCm39) missense probably benign
R7999:Dnah10 UTSW 5 124,802,322 (GRCm39) missense probably benign 0.06
R8017:Dnah10 UTSW 5 124,877,949 (GRCm39) missense probably benign 0.03
R8032:Dnah10 UTSW 5 124,823,676 (GRCm39) missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124,905,575 (GRCm39) missense probably benign 0.00
R8088:Dnah10 UTSW 5 124,831,330 (GRCm39) missense probably benign 0.00
R8169:Dnah10 UTSW 5 124,877,946 (GRCm39) missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124,832,790 (GRCm39) missense probably benign 0.11
R8200:Dnah10 UTSW 5 124,905,524 (GRCm39) missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124,827,858 (GRCm39) missense probably benign 0.29
R8294:Dnah10 UTSW 5 124,859,410 (GRCm39) missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124,909,566 (GRCm39) missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124,850,606 (GRCm39) missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124,813,895 (GRCm39) missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124,893,164 (GRCm39) missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124,803,911 (GRCm39) missense probably benign 0.00
R8723:Dnah10 UTSW 5 124,891,685 (GRCm39) missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124,852,410 (GRCm39) missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124,842,614 (GRCm39) missense probably benign 0.09
R8879:Dnah10 UTSW 5 124,895,181 (GRCm39) missense probably damaging 1.00
R8928:Dnah10 UTSW 5 124,866,828 (GRCm39) missense probably damaging 0.98
R8932:Dnah10 UTSW 5 124,878,015 (GRCm39) missense possibly damaging 0.96
R8945:Dnah10 UTSW 5 124,891,006 (GRCm39) missense probably damaging 0.99
R8990:Dnah10 UTSW 5 124,814,057 (GRCm39) missense
R9001:Dnah10 UTSW 5 124,852,515 (GRCm39) missense probably damaging 1.00
R9006:Dnah10 UTSW 5 124,820,783 (GRCm39) missense probably benign 0.23
R9060:Dnah10 UTSW 5 124,905,141 (GRCm39) missense probably damaging 1.00
R9085:Dnah10 UTSW 5 124,839,237 (GRCm39) missense
R9133:Dnah10 UTSW 5 124,859,423 (GRCm39) missense probably damaging 1.00
R9155:Dnah10 UTSW 5 124,907,475 (GRCm39) missense probably damaging 0.99
R9220:Dnah10 UTSW 5 124,871,437 (GRCm39) missense probably benign 0.05
R9234:Dnah10 UTSW 5 124,818,989 (GRCm39) missense possibly damaging 0.94
R9264:Dnah10 UTSW 5 124,813,900 (GRCm39) missense probably damaging 1.00
R9266:Dnah10 UTSW 5 124,845,990 (GRCm39) missense probably benign 0.00
R9386:Dnah10 UTSW 5 124,871,507 (GRCm39) critical splice donor site probably null
R9446:Dnah10 UTSW 5 124,823,677 (GRCm39) missense probably damaging 1.00
R9484:Dnah10 UTSW 5 124,900,508 (GRCm39) missense probably damaging 1.00
R9594:Dnah10 UTSW 5 124,907,107 (GRCm39) missense probably damaging 1.00
R9691:Dnah10 UTSW 5 124,852,249 (GRCm39) missense probably damaging 0.98
RF015:Dnah10 UTSW 5 124,895,141 (GRCm39) missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124,854,971 (GRCm39) missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
U24488:Dnah10 UTSW 5 124,891,044 (GRCm39) missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124,842,761 (GRCm39) missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124,852,419 (GRCm39) missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124,819,019 (GRCm39) missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124,895,052 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah10 UTSW 5 124,824,683 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agcctgtcttcactctccc -3'
(R):5'- tatccagccccagccag -3'
Posted On 2014-01-05