Incidental Mutation 'R1118:Stk36'
ID97479
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Nameserine/threonine kinase 36
Synonyms1700112N14Rik, Fused
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74601445-74636894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74632766 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 875 (E875G)
Ref Sequence ENSEMBL: ENSMUSP00000120020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
Predicted Effect probably benign
Transcript: ENSMUST00000087183
AA Change: E877G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: E877G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000087186
AA Change: E749G
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: E749G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect probably benign
Transcript: ENSMUST00000148456
AA Change: E875G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: E875G

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155473
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74634702 missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74634085 missense probably benign
IGL00792:Stk36 APN 1 74611117 missense probably benign 0.01
IGL00941:Stk36 APN 1 74623934 missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74625610 missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74633638 missense probably benign 0.03
IGL02143:Stk36 APN 1 74616569 splice site probably benign
IGL02223:Stk36 APN 1 74623337 missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74622255 missense probably benign 0.13
IGL02618:Stk36 APN 1 74631675 splice site probably benign
IGL02655:Stk36 APN 1 74634535 missense probably damaging 1.00
IGL02993:Stk36 APN 1 74622287 missense probably benign 0.05
IGL03125:Stk36 APN 1 74623313 missense probably damaging 1.00
IGL03242:Stk36 APN 1 74623352 missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74633620 missense probably damaging 0.99
R0377:Stk36 UTSW 1 74612730 missense probably benign
R0464:Stk36 UTSW 1 74611172 missense probably damaging 0.98
R0520:Stk36 UTSW 1 74602206 unclassified probably benign
R0551:Stk36 UTSW 1 74616621 missense probably benign 0.00
R1119:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1471:Stk36 UTSW 1 74611155 missense probably benign 0.14
R1915:Stk36 UTSW 1 74634187 missense probably benign 0.08
R2159:Stk36 UTSW 1 74634737 missense probably benign 0.00
R2290:Stk36 UTSW 1 74626144 splice site probably benign
R2897:Stk36 UTSW 1 74632825 missense probably null
R2898:Stk36 UTSW 1 74632825 missense probably null
R4032:Stk36 UTSW 1 74626048 missense probably benign
R4353:Stk36 UTSW 1 74632807 missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74634185 missense probably benign 0.22
R4753:Stk36 UTSW 1 74626096 missense probably benign 0.05
R4891:Stk36 UTSW 1 74603256 missense probably damaging 1.00
R5068:Stk36 UTSW 1 74622345 missense probably benign 0.00
R5115:Stk36 UTSW 1 74635827 missense probably damaging 1.00
R5266:Stk36 UTSW 1 74611158 missense probably benign
R5412:Stk36 UTSW 1 74605456 unclassified probably null
R5533:Stk36 UTSW 1 74626591 missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74605425 missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74634229 missense probably benign 0.00
R6208:Stk36 UTSW 1 74611432 missense probably benign 0.03
R6497:Stk36 UTSW 1 74603232 missense probably damaging 1.00
R6805:Stk36 UTSW 1 74622239 missense probably benign
R7064:Stk36 UTSW 1 74610820 missense probably damaging 1.00
R7102:Stk36 UTSW 1 74622223 missense probably benign 0.10
R7393:Stk36 UTSW 1 74611193 nonsense probably null
R7408:Stk36 UTSW 1 74633566 missense probably damaging 1.00
R7471:Stk36 UTSW 1 74634320 missense unknown
R7816:Stk36 UTSW 1 74611169 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCCTTGACATGAGCAGATCTAAACAG -3'
(R):5'- GCTATGGTAAGAGAAAGCCACCTTGG -3'

Sequencing Primer
(F):5'- aagaagagagagaaagagtgagag -3'
(R):5'- GGGTGAAATCAGTGTCCAGTC -3'
Posted On2014-01-05