Incidental Mutation 'R1118:Sned1'
ID97487
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93281654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 830 (V830M)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062202
AA Change: V830M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: V830M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163688
AA Change: V39M
SMART Domains Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: V39M

DomainStartEndE-ValueType
EGF_CA 1 37 6.7e-7 SMART
EGF_CA 39 75 1.92e-7 SMART
EGF 80 113 2.35e-2 SMART
FN3 116 201 1.7e-4 SMART
FN3 215 294 1.38e-4 SMART
FN3 314 395 1.6e-9 SMART
EGF 487 520 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
R7899:Sned1 UTSW 1 93274082 missense probably benign 0.04
R8093:Sned1 UTSW 1 93274665 missense possibly damaging 0.82
R8124:Sned1 UTSW 1 93282989 critical splice donor site probably null
R8489:Sned1 UTSW 1 93283256 nonsense probably null
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Z1176:Sned1 UTSW 1 93259042 missense probably damaging 1.00
Z1177:Sned1 UTSW 1 93285820 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACTCCCAAGGCTGTGGTGAC -3'
(R):5'- TCCTGAAAAGCCTGACCAAGTGTG -3'

Sequencing Primer
(F):5'- GCTGTGGTGACCCGGAG -3'
(R):5'- GCCTATCCAGGGACAACAGAG -3'
Posted On2014-01-05