Incidental Mutation 'R0989:Olfr552'
ID 97488
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor 552
Synonyms GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
MMRRC Submission 039109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R0989 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102597770-102608125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102604483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 43 (G43D)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: G43D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: G43D

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: G43D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
C4bp G A 1: 130,643,053 T262I probably benign Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Crim1 T C 17: 78,200,944 V59A probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxw11 T C 11: 32,735,149 V328A probably benign Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pcolce2 T A 9: 95,638,723 M51K probably benign Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
R7706:Olfr552 UTSW 7 102604646 missense probably benign 0.12
R8348:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8448:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8919:Olfr552 UTSW 7 102604504 missense probably damaging 1.00
R8933:Olfr552 UTSW 7 102604430 missense probably damaging 1.00
R9009:Olfr552 UTSW 7 102604435 missense probably benign 0.00
R9139:Olfr552 UTSW 7 102604978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATCCCTCTGTACTCCAGATGACC -3'
(R):5'- GATTTCCCGATCCCTGAACCAGAAC -3'

Sequencing Primer
(F):5'- TGAACACTGACTCTGCTGATAG -3'
(R):5'- CAGGGAGAGCATTTTGGGC -3'
Posted On 2014-01-05