Incidental Mutation 'R0989:Pcolce2'
ID97512
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
MMRRC Submission 039109-MU
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0989 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95638723 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 51 (M51K)
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498]
Predicted Effect probably benign
Transcript: ENSMUST00000015498
AA Change: M51K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354
AA Change: M51K

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131619
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
C4bp G A 1: 130,643,053 T262I probably benign Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Crim1 T C 17: 78,200,944 V59A probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxw11 T C 11: 32,735,149 V328A probably benign Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr552 G A 7: 102,604,483 G43D probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2287:Pcolce2 UTSW 9 95678405 nonsense probably null
R2922:Pcolce2 UTSW 9 95694714 missense probably damaging 1.00
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R6883:Pcolce2 UTSW 9 95678343 critical splice acceptor site probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R7949:Pcolce2 UTSW 9 95694635 missense probably benign 0.11
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8369:Pcolce2 UTSW 9 95637794 start codon destroyed probably benign
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTCTTTTAAACCATGCAGCTCTGCC -3'
(R):5'- CTAATCGCTATTGCAGGACATCCCC -3'

Sequencing Primer
(F):5'- TCTGCCAGAGTGACTCTCAATAC -3'
(R):5'- TCCCAGATAGGTGAAGTAAATCC -3'
Posted On2014-01-05