Incidental Mutation 'R1118:Bcan'
ID97513
Institutional Source Beutler Lab
Gene Symbol Bcan
Ensembl Gene ENSMUSG00000004892
Gene Namebrevican
SynonymsCspg7
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87987531-88000230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87989227 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 721 (I721F)
Ref Sequence ENSEMBL: ENSMUSP00000088491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090971]
Predicted Effect probably damaging
Transcript: ENSMUST00000090971
AA Change: I721F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088491
Gene: ENSMUSG00000004892
AA Change: I721F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 51 138 5.74e-13 SMART
LINK 154 251 9.37e-55 SMART
LINK 255 353 2.67e-59 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
EGF 625 658 1.07e-5 SMART
CLECT 664 785 1.15e-33 SMART
CCP 791 847 2.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194596
Meta Mutation Damage Score 0.8529 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired LTP maintenance, but mutant animals show normal behavior and spatial learning capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Bcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Bcan APN 3 87994174 missense probably damaging 1.00
IGL00981:Bcan APN 3 87997832 missense possibly damaging 0.66
IGL02355:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL02362:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL03190:Bcan APN 3 87993050 unclassified probably benign
G1patch:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R0392:Bcan UTSW 3 87993562 nonsense probably null
R0938:Bcan UTSW 3 87993154 missense possibly damaging 0.96
R1559:Bcan UTSW 3 87994212 missense probably damaging 0.96
R1653:Bcan UTSW 3 87994196 missense probably damaging 0.99
R1699:Bcan UTSW 3 87989236 missense probably damaging 1.00
R1762:Bcan UTSW 3 87993625 missense probably benign 0.00
R1802:Bcan UTSW 3 87993108 missense possibly damaging 0.58
R1870:Bcan UTSW 3 87995601 missense probably damaging 1.00
R1929:Bcan UTSW 3 87993094 missense probably damaging 1.00
R2172:Bcan UTSW 3 87996581 missense probably damaging 1.00
R2271:Bcan UTSW 3 87993094 missense probably damaging 1.00
R4036:Bcan UTSW 3 87996116 critical splice donor site probably null
R4363:Bcan UTSW 3 87997098 missense probably damaging 1.00
R4491:Bcan UTSW 3 87990233 nonsense probably null
R5111:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5122:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5167:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5234:Bcan UTSW 3 87996146 missense probably damaging 1.00
R5363:Bcan UTSW 3 87995487 missense probably damaging 1.00
R5365:Bcan UTSW 3 87989235 missense probably damaging 1.00
R5544:Bcan UTSW 3 87993053 critical splice donor site probably null
R5663:Bcan UTSW 3 87995613 missense probably damaging 0.98
R6044:Bcan UTSW 3 87995643 missense probably damaging 1.00
R6495:Bcan UTSW 3 87996597 missense possibly damaging 0.91
R6725:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R6764:Bcan UTSW 3 87988378 missense probably damaging 1.00
R7000:Bcan UTSW 3 87988379 nonsense probably null
R7294:Bcan UTSW 3 87995524 missense possibly damaging 0.51
R7338:Bcan UTSW 3 87994243 missense probably damaging 1.00
R7942:Bcan UTSW 3 87993075 missense probably benign 0.40
R8428:Bcan UTSW 3 87997098 missense probably damaging 1.00
R8487:Bcan UTSW 3 87989209 missense probably damaging 0.98
R8801:Bcan UTSW 3 87997275 missense probably damaging 1.00
R8803:Bcan UTSW 3 87996692 missense probably benign 0.21
R8898:Bcan UTSW 3 87988388 missense probably benign 0.21
X0013:Bcan UTSW 3 87996159 missense possibly damaging 0.69
Z1176:Bcan UTSW 3 87990750 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87990755 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87995650 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGACGCTTGAACCCCATAAGTACC -3'
(R):5'- TTTCCCAGCAGAAGAGGCTAGGTC -3'

Sequencing Primer
(F):5'- CCCCATAAGTACCAGGGGAAATG -3'
(R):5'- AGGCTAGGTCTGAGCCAAC -3'
Posted On2014-01-05