Incidental Mutation 'R0989:Fbxw11'
ID97523
Institutional Source Beutler Lab
Gene Symbol Fbxw11
Ensembl Gene ENSMUSG00000020271
Gene NameF-box and WD-40 domain protein 11
SynonymsHOS, 2310065A07Rik, Fbxw1b, BTRC2, BTRCP2
MMRRC Submission 039109-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0989 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32642724-32746816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32735149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 328 (V328A)
Ref Sequence ENSEMBL: ENSMUSP00000075721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076383] [ENSMUST00000093205] [ENSMUST00000109366]
Predicted Effect probably benign
Transcript: ENSMUST00000076383
AA Change: V328A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075721
Gene: ENSMUSG00000020271
AA Change: V328A

DomainStartEndE-ValueType
Beta-TrCP_D 98 137 5.48e-26 SMART
FBOX 149 188 5.08e-6 SMART
WD40 250 287 6.89e-3 SMART
WD40 290 327 3.78e-9 SMART
WD40 330 367 7.73e-6 SMART
WD40 373 410 9.67e-7 SMART
WD40 413 450 3.93e-7 SMART
WD40 453 490 8.42e-7 SMART
WD40 502 539 2.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093205
AA Change: V307A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090893
Gene: ENSMUSG00000020271
AA Change: V307A

DomainStartEndE-ValueType
Beta-TrCP_D 77 116 5.48e-26 SMART
FBOX 128 167 5.08e-6 SMART
WD40 229 266 6.89e-3 SMART
WD40 269 306 3.78e-9 SMART
WD40 309 346 7.73e-6 SMART
WD40 352 389 9.67e-7 SMART
WD40 392 429 3.93e-7 SMART
WD40 432 469 8.42e-7 SMART
WD40 481 518 2.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109366
AA Change: V294A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104991
Gene: ENSMUSG00000020271
AA Change: V294A

DomainStartEndE-ValueType
Beta-TrCP_D 64 103 5.48e-26 SMART
FBOX 115 154 5.08e-6 SMART
WD40 216 253 6.89e-3 SMART
WD40 256 293 3.78e-9 SMART
WD40 296 333 7.73e-6 SMART
WD40 339 376 9.67e-7 SMART
WD40 379 416 3.93e-7 SMART
WD40 419 456 8.42e-7 SMART
WD40 468 505 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
C4bp G A 1: 130,643,053 T262I probably benign Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Crim1 T C 17: 78,200,944 V59A probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr552 G A 7: 102,604,483 G43D probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pcolce2 T A 9: 95,638,723 M51K probably benign Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in Fbxw11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Fbxw11 APN 11 32722101 missense possibly damaging 0.94
IGL01828:Fbxw11 APN 11 32720505 missense probably damaging 1.00
PIT4651001:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
R0311:Fbxw11 UTSW 11 32722083 missense probably benign 0.00
R0331:Fbxw11 UTSW 11 32711895 missense probably damaging 0.99
R0597:Fbxw11 UTSW 11 32720496 missense probably damaging 1.00
R1175:Fbxw11 UTSW 11 32711922 missense probably damaging 0.96
R1327:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
R1589:Fbxw11 UTSW 11 32733612 missense probably damaging 1.00
R3155:Fbxw11 UTSW 11 32739244 missense possibly damaging 0.93
R4084:Fbxw11 UTSW 11 32739248 missense probably damaging 1.00
R4610:Fbxw11 UTSW 11 32711859 missense possibly damaging 0.48
R4677:Fbxw11 UTSW 11 32742535 nonsense probably null
R4694:Fbxw11 UTSW 11 32642820 unclassified probably benign
R4946:Fbxw11 UTSW 11 32739226 missense probably damaging 1.00
R5027:Fbxw11 UTSW 11 32652811 intron probably benign
R5345:Fbxw11 UTSW 11 32738471 missense probably damaging 1.00
R5459:Fbxw11 UTSW 11 32739191 missense possibly damaging 0.85
R5802:Fbxw11 UTSW 11 32711790 missense probably benign 0.18
R5820:Fbxw11 UTSW 11 32735374 missense probably damaging 1.00
R6181:Fbxw11 UTSW 11 32742575 missense probably benign
R6365:Fbxw11 UTSW 11 32720623 missense possibly damaging 0.75
R6948:Fbxw11 UTSW 11 32742597 missense probably damaging 0.98
R7251:Fbxw11 UTSW 11 32731370 missense probably benign 0.00
R7475:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
X0064:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCAGCAGGTTCCTCAGC -3'
(R):5'- TACATTGACAGCAGCACGGTGG -3'

Sequencing Primer
(F):5'- CAGTGGGAACTGTCAGACTC -3'
(R):5'- GGCCAACCAGAACACGG -3'
Posted On2014-01-05