Incidental Mutation 'R1118:Tia1'
ID97538
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86419109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 96 (V96I)
Ref Sequence ENSEMBL: ENSMUSP00000093426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438]
Predicted Effect probably benign
Transcript: ENSMUST00000095752
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095753
AA Change: V96I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: V96I

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095754
AA Change: V96I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: V96I

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113708
SMART Domains Protein: ENSMUSP00000109338
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113712
AA Change: V96I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337
AA Change: V96I

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113713
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126404
Predicted Effect probably benign
Transcript: ENSMUST00000130967
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147104
Predicted Effect probably benign
Transcript: ENSMUST00000148728
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149270
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205109
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R0322:Tia1 UTSW 6 86420387 missense probably damaging 1.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2275:Tia1 UTSW 6 86427677 missense probably benign 0.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4674:Tia1 UTSW 6 86420400 missense probably damaging 0.99
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7804:Tia1 UTSW 6 86424382 missense probably benign 0.02
R7879:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R7962:Tia1 UTSW 6 86424365 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTGGGCAACAACCCCTAGCAG -3'
(R):5'- ACTAGCAACAAAGTCGTGGACAAGC -3'

Sequencing Primer
(F):5'- CGAGCAGTAAGTACATTTGATGCC -3'
(R):5'- TGGACAAGCCACACTTGGTC -3'
Posted On2014-01-05