Incidental Mutation 'R1118:Mrgpra3'
ID97552
Institutional Source Beutler Lab
Gene Symbol Mrgpra3
Ensembl Gene ENSMUSG00000078698
Gene NameMAS-related GPR, member A3
SynonymsG protein-coupled receptor, MrgA3
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47588950-47601372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47589291 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 296 (L296V)
Ref Sequence ENSEMBL: ENSMUSP00000135437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176369
AA Change: L296V

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135437
Gene: ENSMUSG00000078698
AA Change: L296V

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 234 6.3e-7 PFAM
Pfam:7tm_1 57 286 2.7e-9 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Mrgpra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mrgpra3 APN 7 47589519 missense probably benign 0.00
IGL02097:Mrgpra3 APN 7 47589456 missense possibly damaging 0.94
IGL02101:Mrgpra3 APN 7 47589552 missense probably damaging 0.99
IGL03071:Mrgpra3 APN 7 47589181 utr 3 prime probably benign
PIT4445001:Mrgpra3 UTSW 7 47590160 missense possibly damaging 0.88
R0828:Mrgpra3 UTSW 7 47590136 missense probably benign 0.12
R1835:Mrgpra3 UTSW 7 47589946 nonsense probably null
R2258:Mrgpra3 UTSW 7 47590094 missense probably benign 0.35
R2393:Mrgpra3 UTSW 7 47589617 missense possibly damaging 0.92
R3437:Mrgpra3 UTSW 7 47589566 missense probably damaging 1.00
R3973:Mrgpra3 UTSW 7 47589666 missense probably benign 0.22
R4273:Mrgpra3 UTSW 7 47589432 missense probably benign 0.01
R4495:Mrgpra3 UTSW 7 47590065 missense probably benign 0.00
R4768:Mrgpra3 UTSW 7 47589728 missense possibly damaging 0.94
R4822:Mrgpra3 UTSW 7 47589968 missense possibly damaging 0.69
R4967:Mrgpra3 UTSW 7 47589519 missense probably benign 0.33
R5207:Mrgpra3 UTSW 7 47590161 missense probably benign 0.06
R5569:Mrgpra3 UTSW 7 47590011 missense probably benign 0.00
R5763:Mrgpra3 UTSW 7 47589607 nonsense probably null
R6102:Mrgpra3 UTSW 7 47590149 missense possibly damaging 0.92
R6612:Mrgpra3 UTSW 7 47590035 missense probably benign 0.00
R6718:Mrgpra3 UTSW 7 47589696 missense probably benign 0.25
R6859:Mrgpra3 UTSW 7 47590033 missense probably benign 0.04
R7029:Mrgpra3 UTSW 7 47589542 missense probably benign 0.00
R7034:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7036:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7097:Mrgpra3 UTSW 7 47589641 missense probably benign
R7475:Mrgpra3 UTSW 7 47589947 missense probably damaging 1.00
R8289:Mrgpra3 UTSW 7 47589720 missense possibly damaging 0.76
R8315:Mrgpra3 UTSW 7 47601303 start codon destroyed probably null 0.93
Z1177:Mrgpra3 UTSW 7 47601301 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTGGGCTGTTACCATGACAAG -3'
(R):5'- GTGACCATCATGCTGACCGTTTTG -3'

Sequencing Primer
(F):5'- CATGTCAAGTCAGTAAGCTGAG -3'
(R):5'- CATGCTGACCGTTTTGGTTTTTC -3'
Posted On2014-01-05