Incidental Mutation 'R0989:Crim1'
ID 97563
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
MMRRC Submission 039109-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0989 (G1)
Quality Score 147
Status Not validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78508373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: V59A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V59A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,030,273 (GRCm39) D140G probably damaging Het
Atp7b A G 8: 22,518,710 (GRCm39) S43P possibly damaging Het
C4bp G A 1: 130,570,790 (GRCm39) T262I probably benign Het
Cdh23 A G 10: 60,370,289 (GRCm39) Y169H probably damaging Het
Celsr1 T C 15: 85,915,480 (GRCm39) E831G probably benign Het
Celsr2 A C 3: 108,310,588 (GRCm39) M1498R probably benign Het
Dnah10 A G 5: 124,875,002 (GRCm39) I2560V probably benign Het
Enpp2 A T 15: 54,739,155 (GRCm39) M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fam120a G T 13: 49,039,219 (GRCm39) A979E possibly damaging Het
Fbxw11 T C 11: 32,685,149 (GRCm39) V328A probably benign Het
Gm4846 G A 1: 166,314,689 (GRCm39) S318L possibly damaging Het
Golm1 A T 13: 59,787,997 (GRCm39) Y301N probably benign Het
Ipo8 T C 6: 148,698,180 (GRCm39) T614A probably benign Het
Klhl33 T A 14: 51,129,279 (GRCm39) Y390F probably damaging Het
Minar1 T A 9: 89,484,088 (GRCm39) K436N probably damaging Het
Mlh3 A G 12: 85,316,169 (GRCm39) S6P probably benign Het
Neurod2 A G 11: 98,218,805 (GRCm39) S120P probably damaging Het
Nfkb1 A G 3: 135,295,157 (GRCm39) S896P probably benign Het
Nr3c2 T C 8: 77,914,193 (GRCm39) Y687H probably damaging Het
Or13a24 A C 7: 140,154,200 (GRCm39) I45L probably damaging Het
Or52k2 G A 7: 102,253,690 (GRCm39) G43D probably damaging Het
Parp3 C T 9: 106,350,281 (GRCm39) probably null Het
Pcolce2 T A 9: 95,520,776 (GRCm39) M51K probably benign Het
Pnoc T C 14: 65,642,317 (GRCm39) K149E probably damaging Het
Polr1b T G 2: 128,967,997 (GRCm39) V1130G probably damaging Het
Prcp A T 7: 92,559,424 (GRCm39) I163F probably benign Het
Sez6l2 A G 7: 126,559,016 (GRCm39) D361G probably damaging Het
Slc4a9 T A 18: 36,669,920 (GRCm39) L785* probably null Het
Ssna1 T C 2: 25,161,575 (GRCm39) T91A probably benign Het
St18 A G 1: 6,898,105 (GRCm39) T636A probably benign Het
Tln2 C T 9: 67,136,736 (GRCm39) A1250T probably damaging Het
Tnk2 A G 16: 32,499,176 (GRCm39) M815V probably damaging Het
Tspan31 T A 10: 126,904,196 (GRCm39) H167L probably damaging Het
Tspoap1 T A 11: 87,656,649 (GRCm39) C287S probably damaging Het
Unc80 T C 1: 66,685,599 (GRCm39) F2241S possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1529:Crim1 UTSW 17 78,675,383 (GRCm39) missense probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4154:Crim1 UTSW 17 78,545,272 (GRCm39) missense probably benign 0.01
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R7920:Crim1 UTSW 17 78,610,493 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9702:Crim1 UTSW 17 78,681,516 (GRCm39) missense probably damaging 1.00
R9710:Crim1 UTSW 17 78,610,504 (GRCm39) nonsense probably null
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTTCCCCGGCAATCAGGAGCAG -3'
(R):5'- ACGCCCACTTCGTACTCGGTGATG -3'

Sequencing Primer
(F):5'- cccTAGTGGGGCACGAG -3'
(R):5'- ATGGAGTCGCCATTGAGC -3'
Posted On 2014-01-05