Incidental Mutation 'R0989:Crim1'
ID 97563
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission 039109-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0989 (G1)
Quality Score 147
Status Not validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78200944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: V59A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V59A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
C4bp G A 1: 130,643,053 T262I probably benign Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxw11 T C 11: 32,735,149 V328A probably benign Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr552 G A 7: 102,604,483 G43D probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pcolce2 T A 9: 95,638,723 M51K probably benign Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9402:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9702:Crim1 UTSW 17 78374087 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTTCCCCGGCAATCAGGAGCAG -3'
(R):5'- ACGCCCACTTCGTACTCGGTGATG -3'

Sequencing Primer
(F):5'- cccTAGTGGGGCACGAG -3'
(R):5'- ATGGAGTCGCCATTGAGC -3'
Posted On 2014-01-05