Incidental Mutation 'R1118:Phf11a'
ID97593
Institutional Source Beutler Lab
Gene Symbol Phf11a
Ensembl Gene ENSMUSG00000044703
Gene NamePHD finger protein 11A
Synonyms
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59276913-59297522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59284329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000053146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062307]
Predicted Effect probably benign
Transcript: ENSMUST00000062307
AA Change: D131G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053146
Gene: ENSMUSG00000044703
AA Change: D131G

DomainStartEndE-ValueType
Pfam:zf-HC5HC2H_2 26 142 7.3e-9 PFAM
Pfam:zf-HC5HC2H 51 143 5.8e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Phf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Phf11a APN 14 59287501 missense probably damaging 0.99
IGL01988:Phf11a APN 14 59277358 missense probably damaging 0.96
IGL02614:Phf11a APN 14 59279368 missense possibly damaging 0.80
R1623:Phf11a UTSW 14 59287551 missense possibly damaging 0.91
R1661:Phf11a UTSW 14 59280788 missense probably damaging 1.00
R1928:Phf11a UTSW 14 59281867 splice site probably benign
R2022:Phf11a UTSW 14 59294914 missense possibly damaging 0.77
R4836:Phf11a UTSW 14 59287579 missense probably damaging 0.99
R4983:Phf11a UTSW 14 59284438 missense probably benign 0.05
R5074:Phf11a UTSW 14 59284400 missense possibly damaging 0.94
R5411:Phf11a UTSW 14 59294938 missense probably benign
R5510:Phf11a UTSW 14 59279385 missense probably damaging 1.00
R5512:Phf11a UTSW 14 59287550 missense probably benign 0.12
R6209:Phf11a UTSW 14 59287579 missense probably damaging 1.00
R6337:Phf11a UTSW 14 59284368 missense probably damaging 0.99
R6505:Phf11a UTSW 14 59277537 missense probably damaging 0.98
R7368:Phf11a UTSW 14 59280725 missense probably benign 0.01
R8133:Phf11a UTSW 14 59284324 missense probably damaging 1.00
R8136:Phf11a UTSW 14 59277569 missense probably benign
Z1177:Phf11a UTSW 14 59284342 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCTGAGAAGTTCCTGCTCATATCCC -3'
(R):5'- GAGGTTCAAGGACCCCAAATCCAG -3'

Sequencing Primer
(F):5'- GAAGTTCCTGCTCATATCCCATAAC -3'
(R):5'- CACATGGTTGCTGGCTTAAAC -3'
Posted On2014-01-05