Incidental Mutation 'R1118:Mei1'
ID97609
Institutional Source Beutler Lab
Gene Symbol Mei1
Ensembl Gene ENSMUSG00000068117
Gene Namemeiotic double-stranded break formation protein 1
Synonymsmei1
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82069996-82126814 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 82115867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000186125] [ENSMUST00000188048] [ENSMUST00000189540] [ENSMUST00000229119]
Predicted Effect probably benign
Transcript: ENSMUST00000089178
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186125
Predicted Effect probably benign
Transcript: ENSMUST00000188048
SMART Domains Protein: ENSMUSP00000139689
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189540
SMART Domains Protein: ENSMUSP00000140479
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Homozygous mutant mice of both sexes exhibit meiotic defects and are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Mei1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Mei1 APN 15 82089552 missense probably damaging 0.99
IGL01776:Mei1 APN 15 82095932 critical splice donor site probably null
IGL01864:Mei1 APN 15 82113017 splice site probably benign
IGL02030:Mei1 APN 15 82115743 missense probably benign
IGL02148:Mei1 APN 15 82092711 nonsense probably null
R0135:Mei1 UTSW 15 82071969 nonsense probably null
R0212:Mei1 UTSW 15 82095931 critical splice donor site probably null
R0537:Mei1 UTSW 15 82091361 missense possibly damaging 0.93
R0605:Mei1 UTSW 15 82070150 missense probably benign
R0727:Mei1 UTSW 15 82070149 missense probably benign 0.01
R1226:Mei1 UTSW 15 82080084 missense possibly damaging 0.92
R1339:Mei1 UTSW 15 82081995 missense possibly damaging 0.66
R1558:Mei1 UTSW 15 82107133 missense probably damaging 1.00
R1769:Mei1 UTSW 15 82112570 intron probably null
R1868:Mei1 UTSW 15 82124953 missense probably damaging 1.00
R1980:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1981:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1982:Mei1 UTSW 15 82103312 missense probably benign 0.00
R2103:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R2103:Mei1 UTSW 15 82107036 missense probably damaging 0.99
R2207:Mei1 UTSW 15 82103249 missense probably benign 0.08
R2444:Mei1 UTSW 15 82112941 missense probably damaging 1.00
R3009:Mei1 UTSW 15 82112525 missense probably damaging 0.97
R3114:Mei1 UTSW 15 82124959 missense probably benign 0.31
R3546:Mei1 UTSW 15 82098042 missense probably damaging 0.97
R3720:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3721:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3722:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3752:Mei1 UTSW 15 82086182 missense probably damaging 0.97
R3778:Mei1 UTSW 15 82082008 missense probably damaging 1.00
R3848:Mei1 UTSW 15 82113017 splice site probably benign
R3933:Mei1 UTSW 15 82083152 missense possibly damaging 0.75
R4274:Mei1 UTSW 15 82124863 missense possibly damaging 0.66
R4765:Mei1 UTSW 15 82112485 missense possibly damaging 0.96
R5070:Mei1 UTSW 15 82077603 missense possibly damaging 0.66
R5394:Mei1 UTSW 15 82092756 missense possibly damaging 0.83
R6108:Mei1 UTSW 15 82075188 missense possibly damaging 0.66
R6302:Mei1 UTSW 15 82103238 nonsense probably null
R6849:Mei1 UTSW 15 82079945 missense possibly damaging 0.92
R6913:Mei1 UTSW 15 82089609 missense probably benign 0.06
R6919:Mei1 UTSW 15 82081930 missense probably damaging 0.98
R6959:Mei1 UTSW 15 82124875 missense probably benign 0.01
R7007:Mei1 UTSW 15 82093999 missense probably damaging 0.99
R7202:Mei1 UTSW 15 82092642 missense
R7374:Mei1 UTSW 15 82095908 missense
R7438:Mei1 UTSW 15 82115481 missense
R7757:Mei1 UTSW 15 82082623 intron probably benign
RF051:Mei1 UTSW 15 82070010 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCATTGCTTCTCCGCCTGGATAG -3'
(R):5'- GTGAACTCCTGGTCTCCTGCCG -3'

Sequencing Primer
(F):5'- TCTCCGCCTGGATAGAGGAAG -3'
(R):5'- gccacctcccaaatgcc -3'
Posted On2014-01-05