Incidental Mutation 'R0990:Fbxo24'
ID97610
Institutional Source Beutler Lab
Gene Symbol Fbxo24
Ensembl Gene ENSMUSG00000089984
Gene NameF-box protein 24
Synonyms4933422D21Rik, Fbx24
MMRRC Submission 039110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0990 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137612503-137629002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137618439 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 394 (N394S)
Ref Sequence ENSEMBL: ENSMUSP00000031732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031732] [ENSMUST00000111002] [ENSMUST00000124693] [ENSMUST00000136028] [ENSMUST00000155251]
Predicted Effect probably damaging
Transcript: ENSMUST00000031732
AA Change: N394S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031732
Gene: ENSMUSG00000089984
AA Change: N394S

DomainStartEndE-ValueType
FBOX 29 69 1.48e-7 SMART
Pfam:RCC1 386 432 2.2e-10 PFAM
low complexity region 442 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111002
AA Change: N255S

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106630
Gene: ENSMUSG00000089984
AA Change: N255S

DomainStartEndE-ValueType
Pfam:RCC1 247 293 4.2e-11 PFAM
low complexity region 303 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117679
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136028
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196660
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,325,452 V916A possibly damaging Het
Ank2 T C 3: 126,934,666 I759M possibly damaging Het
Arhgap32 A G 9: 32,255,381 D438G probably damaging Het
Arhgef12 T C 9: 42,972,381 Y1285C probably benign Het
Cfap65 A G 1: 74,921,519 V764A possibly damaging Het
Cog8 T A 8: 107,052,487 probably null Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm9938 A G 19: 23,724,592 probably benign Het
Iars2 A G 1: 185,318,627 F422L probably damaging Het
March3 A T 18: 56,807,798 C87S probably damaging Het
Mettl2 T A 11: 105,137,744 Y307* probably null Het
Mlh3 T C 12: 85,267,765 D549G probably benign Het
Muc4 A G 16: 32,752,722 T867A probably benign Het
Nup210l A T 3: 90,211,925 T1852S probably benign Het
Olfr1110 T A 2: 87,135,742 H193L possibly damaging Het
Pdk4 A T 6: 5,485,577 S371T probably benign Het
Pkm A G 9: 59,678,096 T454A probably damaging Het
Satb2 G A 1: 56,850,184 S340F probably damaging Het
Scel G A 14: 103,581,832 V354I possibly damaging Het
Setdb1 T C 3: 95,340,265 T440A probably benign Het
Sgk1 T C 10: 21,997,086 F230S probably damaging Het
Slc22a23 A T 13: 34,195,467 I439N probably damaging Het
Slc9a5 G A 8: 105,359,446 R615Q probably damaging Het
Smad1 T A 8: 79,343,788 I374F probably damaging Het
Tgm4 A G 9: 123,046,511 E143G probably benign Het
Vmn2r53 A G 7: 12,581,502 S797P probably benign Het
Other mutations in Fbxo24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Fbxo24 APN 5 137624301 missense probably damaging 1.00
IGL01872:Fbxo24 APN 5 137613725 missense probably damaging 1.00
IGL02066:Fbxo24 APN 5 137612870 missense probably damaging 1.00
IGL02078:Fbxo24 APN 5 137624349 missense probably damaging 1.00
IGL02330:Fbxo24 APN 5 137621317 missense probably damaging 1.00
PIT4131001:Fbxo24 UTSW 5 137621902 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0243:Fbxo24 UTSW 5 137624557 missense probably damaging 0.98
R1331:Fbxo24 UTSW 5 137619629 missense probably damaging 1.00
R2139:Fbxo24 UTSW 5 137613065 missense probably damaging 0.99
R5483:Fbxo24 UTSW 5 137618740 missense probably damaging 0.99
R5487:Fbxo24 UTSW 5 137618832 missense possibly damaging 0.88
R5954:Fbxo24 UTSW 5 137619681 missense probably damaging 1.00
R5974:Fbxo24 UTSW 5 137619650 missense probably benign 0.12
R6250:Fbxo24 UTSW 5 137621281 missense probably damaging 1.00
R6600:Fbxo24 UTSW 5 137612873 missense probably damaging 1.00
R7345:Fbxo24 UTSW 5 137621261 missense probably damaging 0.99
R7412:Fbxo24 UTSW 5 137619623 missense possibly damaging 0.48
R8017:Fbxo24 UTSW 5 137612811 missense probably benign
R8775:Fbxo24 UTSW 5 137612951 missense possibly damaging 0.62
R8775-TAIL:Fbxo24 UTSW 5 137612951 missense possibly damaging 0.62
X0064:Fbxo24 UTSW 5 137621236 missense probably damaging 1.00
Z1176:Fbxo24 UTSW 5 137621403 missense probably damaging 1.00
Z1177:Fbxo24 UTSW 5 137621299 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCAGACCTTCTCGGACAAGAC -3'
(R):5'- TTGGGACCCTTCAAGCCTTTGAC -3'

Sequencing Primer
(F):5'- CCGGGTGTTATAAGTGATGGG -3'
(R):5'- CTGCCAAGGTAGGATGCTG -3'
Posted On2014-01-05