Incidental Mutation 'R1118:Pdxdc1'
ID97613
Institutional Source Beutler Lab
Gene Symbol Pdxdc1
Ensembl Gene ENSMUSG00000022680
Gene Namepyridoxal-dependent decarboxylase domain containing 1
Synonyms2210010A19Rik
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13833148-13903131 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 13879414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023361] [ENSMUST00000115802] [ENSMUST00000115803] [ENSMUST00000115804]
Predicted Effect probably benign
Transcript: ENSMUST00000023361
SMART Domains Protein: ENSMUSP00000023361
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 166 310 2.6e-12 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115802
SMART Domains Protein: ENSMUSP00000111468
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 153 316 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115803
SMART Domains Protein: ENSMUSP00000111469
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 190 293 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115804
SMART Domains Protein: ENSMUSP00000111471
Gene: ENSMUSG00000022680

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 154 308 5.5e-15 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Pdxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Pdxdc1 APN 16 13859152 missense probably damaging 1.00
IGL02101:Pdxdc1 APN 16 13869856 missense probably damaging 0.99
IGL02484:Pdxdc1 APN 16 13876081 missense possibly damaging 0.94
IGL02523:Pdxdc1 APN 16 13881935 missense probably damaging 1.00
IGL02560:Pdxdc1 APN 16 13839732 missense probably benign 0.00
IGL02884:Pdxdc1 APN 16 13843795 missense possibly damaging 0.86
IGL03008:Pdxdc1 APN 16 13876159 missense possibly damaging 0.81
IGL03162:Pdxdc1 APN 16 13857417 missense probably damaging 0.99
IGL02991:Pdxdc1 UTSW 16 13857396 missense probably damaging 1.00
PIT4472001:Pdxdc1 UTSW 16 13845345 missense probably damaging 1.00
R0015:Pdxdc1 UTSW 16 13887683 splice site probably benign
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0432:Pdxdc1 UTSW 16 13854400 missense probably damaging 0.97
R0846:Pdxdc1 UTSW 16 13854393 critical splice donor site probably null
R0944:Pdxdc1 UTSW 16 13838369 missense probably damaging 1.00
R0945:Pdxdc1 UTSW 16 13857432 missense probably damaging 1.00
R1726:Pdxdc1 UTSW 16 13838300 critical splice donor site probably null
R2425:Pdxdc1 UTSW 16 13879508 missense possibly damaging 0.90
R3890:Pdxdc1 UTSW 16 13836448 missense probably benign
R4452:Pdxdc1 UTSW 16 13837126 missense possibly damaging 0.55
R4516:Pdxdc1 UTSW 16 13838346 nonsense probably null
R4938:Pdxdc1 UTSW 16 13876069 missense probably benign 0.03
R5352:Pdxdc1 UTSW 16 13840311 missense probably benign 0.01
R5554:Pdxdc1 UTSW 16 13872499 missense probably benign 0.01
R7300:Pdxdc1 UTSW 16 13879510 missense probably damaging 0.99
R7356:Pdxdc1 UTSW 16 13860003 missense probably damaging 1.00
R7963:Pdxdc1 UTSW 16 13876166 missense possibly damaging 0.93
R8930:Pdxdc1 UTSW 16 13854405 missense probably damaging 1.00
R8932:Pdxdc1 UTSW 16 13854405 missense probably damaging 1.00
Z1176:Pdxdc1 UTSW 16 13903043 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ggagaggttaagcaacAACTCCAAAGAA -3'
(R):5'- CCACACTTTGAGCATCTTGAGGACATT -3'

Sequencing Primer
(F):5'- tgtctgccattcgcctc -3'
(R):5'- CTGGATCTCTCTGTAGGAGATGAAG -3'
Posted On2014-01-05