Incidental Mutation 'R1118:Gsk3b'
ID97617
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 38207984 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
Predicted Effect probably benign
Transcript: ENSMUST00000023507
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114750
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184976
Predicted Effect probably benign
Transcript: ENSMUST00000231437
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
PIT4585001:Gsk3b UTSW 16 38184454 missense probably damaging 1.00
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1119:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 splice site probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5134:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5726:Gsk3b UTSW 16 38208136 intron probably benign
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
R8344:Gsk3b UTSW 16 38191625 missense probably benign 0.07
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTCAGTCCCTGGAATCTTGCCC -3'
(R):5'- TGAGCCACCTTCACAGAGAACTGC -3'

Sequencing Primer
(F):5'- ccctggaatcttgccctagtAATG -3'
(R):5'- GAGAACTGCTGAGTTTGTAATTGAC -3'
Posted On2014-01-05