Incidental Mutation 'R1118:Cd200r2'
ID97622
Institutional Source Beutler Lab
Gene Symbol Cd200r2
Ensembl Gene ENSMUSG00000090176
Gene NameCd200 receptor 2
SynonymsCD200 cell surface glycoprotein receptor isoform 2
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44867097-44915840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44909606 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 171 (N171S)
Ref Sequence ENSEMBL: ENSMUSP00000099869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102805]
Predicted Effect probably damaging
Transcript: ENSMUST00000102805
AA Change: N171S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099869
Gene: ENSMUSG00000090176
AA Change: N171S

DomainStartEndE-ValueType
IG 23 126 1.06e-2 SMART
IG_like 128 249 1.85e2 SMART
Meta Mutation Damage Score 0.7621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Pgc T A 17: 47,728,903 probably null Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Cd200r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cd200r2 APN 16 44909288 missense probably damaging 1.00
IGL01019:Cd200r2 APN 16 44909469 splice site probably benign
IGL01480:Cd200r2 APN 16 44909266 missense probably null 1.00
IGL01510:Cd200r2 APN 16 44909311 missense probably benign 0.03
IGL02202:Cd200r2 APN 16 44909360 missense probably damaging 1.00
IGL02492:Cd200r2 APN 16 44909540 missense probably damaging 1.00
IGL02499:Cd200r2 APN 16 44914585 missense possibly damaging 0.47
R0066:Cd200r2 UTSW 16 44909674 missense possibly damaging 0.94
R0066:Cd200r2 UTSW 16 44909674 missense possibly damaging 0.94
R0503:Cd200r2 UTSW 16 44877962 start codon destroyed probably null 0.93
R0526:Cd200r2 UTSW 16 44915047 missense probably damaging 1.00
R1119:Cd200r2 UTSW 16 44909606 missense probably damaging 1.00
R2393:Cd200r2 UTSW 16 44909267 missense probably damaging 1.00
R5450:Cd200r2 UTSW 16 44909571 missense probably benign 0.04
R7466:Cd200r2 UTSW 16 44909174 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTCCAAGTGCTGGGTAAGAGAC -3'
(R):5'- TCAACTTGACACAGCTTAGAGCCAC -3'

Sequencing Primer
(F):5'- TGCTGGGTAAGAGACATTGTCAC -3'
(R):5'- cacagcttagagccaccttag -3'
Posted On2014-01-05