Incidental Mutation 'R1118:Pgc'
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Nameprogastricsin (pepsinogen C)
SynonymsUpg1, 2210410L06Rik, Upg-1
MMRRC Submission 039191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1118 (G1)
Quality Score225
Status Validated
Chromosomal Location47726842-47734482 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 47728903 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000144955]
Predicted Effect probably null
Transcript: ENSMUST00000024782
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987

signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G A 7: 29,534,244 noncoding transcript Het
Apcdd1 A G 18: 62,952,024 T431A probably benign Het
Bcan T A 3: 87,989,227 I721F probably damaging Het
Card10 T C 15: 78,802,443 D58G possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Celsr1 T C 15: 86,032,047 D575G probably damaging Het
Ces1f A G 8: 93,267,242 probably benign Het
Cped1 A T 6: 22,237,699 H938L probably benign Het
Creld1 A G 6: 113,491,695 D259G probably benign Het
Cubn T C 2: 13,336,242 I2223V possibly damaging Het
Dopey1 A G 9: 86,515,406 D921G probably damaging Het
Dusp7 T C 9: 106,373,650 S325P possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fat4 A T 3: 38,982,942 D3581V possibly damaging Het
Fhl3 T C 4: 124,705,791 probably null Het
Gap43 T C 16: 42,291,804 E198G probably benign Het
Grina T C 15: 76,248,579 F182S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haus6 A G 4: 86,585,326 probably null Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Itih4 C A 14: 30,896,167 probably benign Het
Kif22 A G 7: 127,032,744 S384P probably benign Het
Lbr A C 1: 181,820,668 probably benign Het
Mei1 G A 15: 82,115,867 probably benign Het
Misp T C 10: 79,827,135 V462A probably benign Het
Mrgpra3 A C 7: 47,589,291 L296V possibly damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Olfr1306 T A 2: 111,912,877 T18S probably benign Het
Otud4 C T 8: 79,653,351 probably benign Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb15 T A 18: 37,473,762 F16I probably benign Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pdxdc1 T A 16: 13,879,414 probably benign Het
Phf11a T C 14: 59,284,329 D131G probably benign Het
Prdm2 G A 4: 143,132,383 H1446Y possibly damaging Het
Rad54b T C 4: 11,563,352 S4P probably damaging Het
Slc52a2 T C 15: 76,539,608 probably benign Het
Slc9a4 G A 1: 40,584,330 probably benign Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sspo A G 6: 48,459,418 Y1234C probably damaging Het
Stab2 A T 10: 86,885,718 probably null Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Stmn4 T G 14: 66,354,395 probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tex14 A T 11: 87,522,517 R1031S probably benign Het
Tia1 G A 6: 86,419,109 V96I probably benign Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trpm7 A G 2: 126,822,486 M991T possibly damaging Het
Ttc3 T A 16: 94,416,268 probably benign Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Vmn2r107 G A 17: 20,356,598 R286Q probably benign Het
Wrap73 A T 4: 154,152,427 probably null Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 47728755 nonsense probably null
R0736:Pgc UTSW 17 47728780 missense probably damaging 1.00
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R6829:Pgc UTSW 17 47732781 splice site probably null
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
R7508:Pgc UTSW 17 47734186 missense probably benign 0.00
R8022:Pgc UTSW 17 47728776 missense probably benign 0.00
Z1176:Pgc UTSW 17 47728868 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tggaaggagaaagggaagaaag -3'
Posted On2014-01-05