Mutagenetix > Incidental Mutation

Incidental Mutation 'R1118:Apcdd1'

97641

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

039191-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R1118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62952024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 431 (T431A)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably benign
Transcript: ENSMUST00000096554
AA Change: T431A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: T431A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163716
AA Change: T431A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: T431A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.3%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	G	A	7: 29,534,244		noncoding transcript	Het
Bcan	T	A	3: 87,989,227	I721F	probably damaging	Het
Card10	T	C	15: 78,802,443	D58G	possibly damaging	Het
Ccdc129	T	C	6: 55,889,170	F183L	probably damaging	Het
Cd200r2	A	G	16: 44,909,606	N171S	probably damaging	Het
Celsr1	T	C	15: 86,032,047	D575G	probably damaging	Het
Ces1f	A	G	8: 93,267,242		probably benign	Het
Cped1	A	T	6: 22,237,699	H938L	probably benign	Het
Creld1	A	G	6: 113,491,695	D259G	probably benign	Het
Cubn	T	C	2: 13,336,242	I2223V	possibly damaging	Het
Dopey1	A	G	9: 86,515,406	D921G	probably damaging	Het
Dusp7	T	C	9: 106,373,650	S325P	possibly damaging	Het
Fam71a	G	A	1: 191,164,485		probably benign	Het
Fat4	A	T	3: 38,982,942	D3581V	possibly damaging	Het
Fhl3	T	C	4: 124,705,791		probably null	Het
Gap43	T	C	16: 42,291,804	E198G	probably benign	Het
Grina	T	C	15: 76,248,579	F182S	probably damaging	Het
Gsk3b	T	C	16: 38,207,984		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Haus6	A	G	4: 86,585,326		probably null	Het
Hmcn1	C	T	1: 150,618,928	A4137T	possibly damaging	Het
Itih4	C	A	14: 30,896,167		probably benign	Het
Kif22	A	G	7: 127,032,744	S384P	probably benign	Het
Lbr	A	C	1: 181,820,668		probably benign	Het
Mei1	G	A	15: 82,115,867		probably benign	Het
Misp	T	C	10: 79,827,135	V462A	probably benign	Het
Mrgpra3	A	C	7: 47,589,291	L296V	possibly damaging	Het
Ndufa9	A	T	6: 126,822,068	L362Q	probably damaging	Het
Nlrp9c	A	T	7: 26,384,437	D572E	probably benign	Het
Olfr1306	T	A	2: 111,912,877	T18S	probably benign	Het
Otud4	C	T	8: 79,653,351		probably benign	Het
P4ha3	T	C	7: 100,313,328	I431T	probably damaging	Het
Pcdhb15	T	A	18: 37,473,762	F16I	probably benign	Het
Pcnp	A	G	16: 56,024,391	S49P	probably damaging	Het
Pdxdc1	T	A	16: 13,879,414		probably benign	Het
Pgc	T	A	17: 47,728,903		probably null	Het
Phf11a	T	C	14: 59,284,329	D131G	probably benign	Het
Prdm2	G	A	4: 143,132,383	H1446Y	possibly damaging	Het
Rad54b	T	C	4: 11,563,352	S4P	probably damaging	Het
Slc52a2	T	C	15: 76,539,608		probably benign	Het
Slc9a4	G	A	1: 40,584,330		probably benign	Het
Smad4	T	C	18: 73,640,262	D551G	probably benign	Het
Smg7	A	T	1: 152,866,575		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sspo	A	G	6: 48,459,418	Y1234C	probably damaging	Het
Stab2	A	T	10: 86,885,718		probably null	Het
Stk36	A	G	1: 74,632,766	E875G	probably benign	Het
Stmn4	T	G	14: 66,354,395		probably benign	Het
Tagln3	C	A	16: 45,724,272	R12L	probably damaging	Het
Tex14	A	T	11: 87,522,517	R1031S	probably benign	Het
Tia1	G	A	6: 86,419,109	V96I	probably benign	Het
Ticrr	C	T	7: 79,693,953	P1189S	probably benign	Het
Tnxb	G	A	17: 34,685,043	V1053M	probably damaging	Het
Tpp2	T	C	1: 43,992,396		probably null	Het
Trpm7	A	G	2: 126,822,486	M991T	possibly damaging	Het
Ttc3	T	A	16: 94,416,268		probably benign	Het
Vcan	G	A	13: 89,705,663	P393S	probably damaging	Het
Vmn2r107	G	A	17: 20,356,598	R286Q	probably benign	Het
Wrap73	A	T	4: 154,152,427		probably null	Het
Zfp958	A	T	8: 4,626,169	N46Y	possibly damaging	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9480:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9520:Apcdd1	UTSW	18	62950119	missense	possibly damaging	0.85
R9521:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9599:Apcdd1	UTSW	18	62950198	critical splice donor site	probably null
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTGCCAGAAGTGTCTGCCTCC -3'
(R):5'- CCCTGCCATACAGATGACCTTGAC -3'

Sequencing Primer
(F):5'- GTGAATCACATGAAGGTTACTCCC -3'
(R):5'- ATACAGATGACCTTGACTGTCTTC -3'

Posted On

2014-01-05