Mutagenetix > Incidental Mutation

Incidental Mutation 'R0990:Slc22a23'

97656

Institutional Source

Beutler Lab

Gene Symbol

Slc22a23

Ensembl Gene

ENSMUSG00000038267

Gene Name

solute carrier family 22, member 23

Synonyms

3110004L20Rik

MMRRC Submission

039110-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R0990 (G1)

Quality Score

164

Status

Not validated

Chromosome

Chromosomal Location

34179158-34345182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34195467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 439 (I439N)

Ref Sequence

ENSEMBL: ENSMUSP00000042742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040336]

AlphaFold

Q3UHH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040336
AA Change: I439N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: I439N

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
Pfam:Sugar_tr	187	633	5e-26	PFAM
Pfam:MFS_1	224	518	2.6e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128392

Predicted Effect

unknown
Transcript: ENSMUST00000148390
AA Change: I323N

SMART Domains

Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: I323N

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
Pfam:Sugar_tr	71	510	1.4e-27	PFAM
Pfam:MFS_1	109	402	1.5e-12	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 94.1%
20x: 86.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	T	C	8: 88,325,452	V916A	possibly damaging	Het
Ank2	T	C	3: 126,934,666	I759M	possibly damaging	Het
Arhgap32	A	G	9: 32,255,381	D438G	probably damaging	Het
Arhgef12	T	C	9: 42,972,381	Y1285C	probably benign	Het
Cfap65	A	G	1: 74,921,519	V764A	possibly damaging	Het
Cog8	T	A	8: 107,052,487		probably null	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fbxo24	T	C	5: 137,618,439	N394S	probably damaging	Het
Gm9938	A	G	19: 23,724,592		probably benign	Het
Iars2	A	G	1: 185,318,627	F422L	probably damaging	Het
March3	A	T	18: 56,807,798	C87S	probably damaging	Het
Mettl2	T	A	11: 105,137,744	Y307*	probably null	Het
Mlh3	T	C	12: 85,267,765	D549G	probably benign	Het
Muc4	A	G	16: 32,752,722	T867A	probably benign	Het
Nup210l	A	T	3: 90,211,925	T1852S	probably benign	Het
Olfr1110	T	A	2: 87,135,742	H193L	possibly damaging	Het
Pdk4	A	T	6: 5,485,577	S371T	probably benign	Het
Pkm	A	G	9: 59,678,096	T454A	probably damaging	Het
Satb2	G	A	1: 56,850,184	S340F	probably damaging	Het
Scel	G	A	14: 103,581,832	V354I	possibly damaging	Het
Setdb1	T	C	3: 95,340,265	T440A	probably benign	Het
Sgk1	T	C	10: 21,997,086	F230S	probably damaging	Het
Slc9a5	G	A	8: 105,359,446	R615Q	probably damaging	Het
Smad1	T	A	8: 79,343,788	I374F	probably damaging	Het
Tgm4	A	G	9: 123,046,511	E143G	probably benign	Het
Vmn2r53	A	G	7: 12,581,502	S797P	probably benign	Het

Other mutations in Slc22a23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Slc22a23	APN	13	34305245	missense	probably damaging	1.00
IGL01762:Slc22a23	APN	13	34204001	missense	possibly damaging	0.71
IGL02496:Slc22a23	APN	13	34344485	missense	possibly damaging	0.93
IGL02516:Slc22a23	APN	13	34203955	missense	probably benign	0.02
IGL02831:Slc22a23	APN	13	34299069	missense	possibly damaging	0.81
Foreshadowed	UTSW	13	34195479	missense	probably damaging	0.98
foretold	UTSW	13	34305180	missense	probably benign	0.08
BB009:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
BB019:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0413:Slc22a23	UTSW	13	34183132	missense	probably damaging	1.00
R0557:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0558:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0636:Slc22a23	UTSW	13	34299093	missense	probably benign	0.01
R0676:Slc22a23	UTSW	13	34195479	missense	probably damaging	0.98
R0739:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R1515:Slc22a23	UTSW	13	34203964	missense	probably benign	0.33
R2128:Slc22a23	UTSW	13	34203970	missense	possibly damaging	0.76
R2147:Slc22a23	UTSW	13	34183007	missense	probably benign	0.00
R3113:Slc22a23	UTSW	13	34183075	missense	probably damaging	0.98
R3780:Slc22a23	UTSW	13	34344340	missense	probably benign	0.14
R3945:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R3946:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R4056:Slc22a23	UTSW	13	34299004	nonsense	probably null
R4095:Slc22a23	UTSW	13	34305206	missense	probably damaging	1.00
R4854:Slc22a23	UTSW	13	34203941	missense	probably benign
R5594:Slc22a23	UTSW	13	34305257	missense	probably damaging	0.99
R5611:Slc22a23	UTSW	13	34305239	missense	probably benign	0.00
R6167:Slc22a23	UTSW	13	34344559	missense	probably damaging	0.97
R6927:Slc22a23	UTSW	13	34344379	missense	probably benign	0.07
R6933:Slc22a23	UTSW	13	34305180	missense	probably benign	0.08
R6960:Slc22a23	UTSW	13	34344157	critical splice donor site	probably null
R7291:Slc22a23	UTSW	13	34197839	missense	probably damaging	0.99
R7313:Slc22a23	UTSW	13	34183178	missense	probably damaging	1.00
R7932:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R8058:Slc22a23	UTSW	13	34305184	nonsense	probably null
R9385:Slc22a23	UTSW	13	34344578	missense	probably benign	0.05
R9560:Slc22a23	UTSW	13	34197868	missense	possibly damaging	0.51
R9630:Slc22a23	UTSW	13	34195407	missense	possibly damaging	0.93
X0064:Slc22a23	UTSW	13	34344466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCTACTCACAGTTGAGAAGCC -3'
(R):5'- GCTTTGTCCTACACCCTTGGTGAAC -3'

Sequencing Primer
(F):5'- GTTGAGAAGCCCGAGCTG -3'
(R):5'- CTTGGTGAACAAAAATACCTCAAGG -3'

Posted On

2014-01-05