Incidental Mutation 'R1119:Smg7'
ID97671
Institutional Source Beutler Lab
Gene Symbol Smg7
Ensembl Gene ENSMUSG00000042772
Gene NameSmg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms9430023P16Rik
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152836995-152902646 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 152866575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836]
Predicted Effect probably benign
Transcript: ENSMUST00000043560
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073441
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111836
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186692
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is essential for nonsense-mediated mRNA decay (NMD); a process whereby transcripts with premature termination codons are targeted for rapid degradation by a mRNA decay complex. The mRNA decay complex consists, in part, of this protein along with proteins SMG5 and UPF1. The N-terminal domain of this protein is thought to mediate its association with SMG5 or UPF1 while the C-terminal domain interacts with the mRNA decay complex. This protein may therefore couple changes in UPF1 phosphorylation state to the degradation of NMD-candidate transcripts. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Smg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Smg7 APN 1 152844061 missense possibly damaging 0.68
IGL02320:Smg7 APN 1 152868337 missense possibly damaging 0.49
IGL02336:Smg7 APN 1 152843279 missense probably benign
IGL02680:Smg7 APN 1 152845394 missense probably benign 0.15
IGL03232:Smg7 APN 1 152840156 missense probably damaging 1.00
chill UTSW 1 152840136 unclassified probably null
R0322:Smg7 UTSW 1 152849873 critical splice donor site probably null
R0540:Smg7 UTSW 1 152855962 missense probably benign 0.00
R0685:Smg7 UTSW 1 152866648 missense probably damaging 1.00
R0707:Smg7 UTSW 1 152870757 splice site probably null
R1109:Smg7 UTSW 1 152845583 missense probably damaging 1.00
R1118:Smg7 UTSW 1 152866575 splice site probably benign
R1458:Smg7 UTSW 1 152855843 splice site probably null
R1759:Smg7 UTSW 1 152848846 missense probably benign 0.20
R1846:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R2015:Smg7 UTSW 1 152860508 missense probably damaging 1.00
R2155:Smg7 UTSW 1 152840313 missense possibly damaging 0.49
R2199:Smg7 UTSW 1 152854328 missense probably damaging 1.00
R2234:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R2235:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R3861:Smg7 UTSW 1 152852598 missense probably null 1.00
R4597:Smg7 UTSW 1 152840301 critical splice donor site probably null
R4672:Smg7 UTSW 1 152845413 missense probably damaging 1.00
R4851:Smg7 UTSW 1 152844269 missense probably benign 0.00
R5486:Smg7 UTSW 1 152846176 missense probably damaging 0.97
R5607:Smg7 UTSW 1 152843234 missense probably damaging 0.98
R6131:Smg7 UTSW 1 152845211 critical splice donor site probably null
R6396:Smg7 UTSW 1 152848600 missense probably benign 0.33
R6401:Smg7 UTSW 1 152840136 unclassified probably null
R6905:Smg7 UTSW 1 152850006 splice site probably null
R6961:Smg7 UTSW 1 152841583 nonsense probably null
R7051:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R7124:Smg7 UTSW 1 152878080 missense probably benign 0.01
R7146:Smg7 UTSW 1 152861825 missense probably benign 0.34
R7573:Smg7 UTSW 1 152859489 missense probably damaging 1.00
R7578:Smg7 UTSW 1 152845430 missense probably damaging 1.00
R7621:Smg7 UTSW 1 152841544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATGCGGTCTGATCACATGTTTCC -3'
(R):5'- AGTGTCTGCCCAGTGAGTCACTAC -3'

Sequencing Primer
(F):5'- TAAACCTCCATCCTACGCATGTATC -3'
(R):5'- TGCCCAGTGAGTCACTACTATAC -3'
Posted On2014-01-05