Mutagenetix > Incidental Mutation

Incidental Mutation 'R0991:Sf3b1'

97687

Institutional Source

Beutler Lab

Gene Symbol

Sf3b1

Ensembl Gene

ENSMUSG00000025982

Gene Name

splicing factor 3b, subunit 1

Synonyms

Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4

MMRRC Submission

039111-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0991 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55024328-55066640 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55058554 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 12 (E12Q)

Ref Sequence

ENSEMBL: ENSMUSP00000139469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027127
AA Change: E12Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: E12Q

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC
internal_repeat_1	185	276	1.77e-12	PROSPERO
Pfam:SF3b1	329	452	1.2e-51	PFAM
SCOP:d1qbkb_	489	1289	5e-62	SMART
Blast:ARM	593	637	6e-13	BLAST
Blast:ARM	1005	1044	7e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189051

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191303
AA Change: E12Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: E12Q

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC

Meta Mutation Damage Score

0.1366

Coding Region Coverage

1x: 99.0%
3x: 97.4%
10x: 91.6%
20x: 77.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	A	18: 34,449,160 (GRCm39)	C1985S	probably damaging	Het
Atp8a2	T	C	14: 60,031,378 (GRCm39)	S899G	probably benign	Het
Dna2	C	T	10: 62,784,966 (GRCm39)	R28W	probably benign	Het
Dtwd1	G	A	2: 126,001,940 (GRCm39)	R220Q	probably damaging	Het
Edil3	A	T	13: 89,437,625 (GRCm39)	K409*	probably null	Het
Ltbp1	A	G	17: 75,532,280 (GRCm39)	Q118R	possibly damaging	Het
Mia	G	A	7: 26,880,145 (GRCm39)	R81C	probably damaging	Het
Pik3c2a	A	G	7: 115,961,280 (GRCm39)		probably null	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Rd3	A	G	1: 191,717,199 (GRCm39)	E223G	probably damaging	Het
Tenm2	C	T	11: 35,954,004 (GRCm39)	G1236R	possibly damaging	Het
Vmn1r65	G	A	7: 6,012,076 (GRCm39)	P53S	probably damaging	Het
Xrn2	A	G	2: 146,884,002 (GRCm39)	K587R	probably benign	Het

Other mutations in Sf3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Sf3b1	APN	1	55,026,645 (GRCm39)	missense	probably damaging	1.00
IGL00815:Sf3b1	APN	1	55,036,090 (GRCm39)	splice site	probably benign
IGL01380:Sf3b1	APN	1	55,027,108 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sf3b1	APN	1	55,026,588 (GRCm39)	missense	probably benign	0.17
IGL02974:Sf3b1	APN	1	55,046,866 (GRCm39)	missense	probably benign	0.00
IGL03159:Sf3b1	APN	1	55,051,372 (GRCm39)	missense	probably benign
Colt	UTSW	1	55,036,315 (GRCm39)	missense	probably benign	0.45
Glock	UTSW	1	55,040,205 (GRCm39)	missense	probably damaging	0.96
Handgun	UTSW	1	55,046,666 (GRCm39)	missense	probably damaging	1.00
Kalashnikov	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
Magazine	UTSW	1	55,051,341 (GRCm39)	nonsense	probably null
Revolver	UTSW	1	55,058,548 (GRCm39)	nonsense	probably null
R0053:Sf3b1	UTSW	1	55,039,532 (GRCm39)	nonsense	probably null
R0053:Sf3b1	UTSW	1	55,039,532 (GRCm39)	nonsense	probably null
R0190:Sf3b1	UTSW	1	55,029,465 (GRCm39)	missense	probably damaging	0.99
R0277:Sf3b1	UTSW	1	55,058,416 (GRCm39)	missense	probably damaging	0.99
R0323:Sf3b1	UTSW	1	55,058,416 (GRCm39)	missense	probably damaging	0.99
R0369:Sf3b1	UTSW	1	55,037,267 (GRCm39)	missense	probably benign	0.10
R0396:Sf3b1	UTSW	1	55,058,430 (GRCm39)	missense	probably damaging	1.00
R0718:Sf3b1	UTSW	1	55,058,544 (GRCm39)	missense	probably damaging	0.99
R1082:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1083:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1084:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1196:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1376:Sf3b1	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
R1376:Sf3b1	UTSW	1	55,058,424 (GRCm39)	missense	probably damaging	0.99
R1381:Sf3b1	UTSW	1	55,042,313 (GRCm39)	missense	probably damaging	0.99
R1436:Sf3b1	UTSW	1	55,040,580 (GRCm39)	missense	possibly damaging	0.72
R1559:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1560:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1561:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1567:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1568:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1588:Sf3b1	UTSW	1	55,036,336 (GRCm39)	missense	probably benign	0.05
R1625:Sf3b1	UTSW	1	55,058,536 (GRCm39)	missense	probably damaging	1.00
R1694:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	possibly damaging	0.89
R1735:Sf3b1	UTSW	1	55,039,811 (GRCm39)	missense	probably damaging	1.00
R1900:Sf3b1	UTSW	1	55,037,347 (GRCm39)	missense	possibly damaging	0.75
R2186:Sf3b1	UTSW	1	55,046,792 (GRCm39)	missense	probably benign
R2429:Sf3b1	UTSW	1	55,055,960 (GRCm39)	missense	possibly damaging	0.71
R2473:Sf3b1	UTSW	1	55,038,785 (GRCm39)	critical splice donor site	probably null
R3772:Sf3b1	UTSW	1	55,039,150 (GRCm39)	intron	probably benign
R3911:Sf3b1	UTSW	1	55,058,548 (GRCm39)	nonsense	probably null
R3970:Sf3b1	UTSW	1	55,051,341 (GRCm39)	nonsense	probably null
R4706:Sf3b1	UTSW	1	55,029,666 (GRCm39)	missense	probably damaging	1.00
R4707:Sf3b1	UTSW	1	55,029,666 (GRCm39)	missense	probably damaging	1.00
R4964:Sf3b1	UTSW	1	55,038,871 (GRCm39)	missense	probably benign
R5053:Sf3b1	UTSW	1	55,036,336 (GRCm39)	missense	probably benign	0.05
R5358:Sf3b1	UTSW	1	55,042,469 (GRCm39)	missense	probably benign	0.09
R5379:Sf3b1	UTSW	1	55,042,309 (GRCm39)	missense	possibly damaging	0.94
R5628:Sf3b1	UTSW	1	55,037,334 (GRCm39)	missense	probably benign	0.27
R5636:Sf3b1	UTSW	1	55,036,352 (GRCm39)	missense	probably damaging	1.00
R6013:Sf3b1	UTSW	1	55,039,457 (GRCm39)	missense	probably damaging	0.98
R6149:Sf3b1	UTSW	1	55,046,666 (GRCm39)	missense	probably damaging	1.00
R6217:Sf3b1	UTSW	1	55,046,677 (GRCm39)	missense	probably damaging	1.00
R6426:Sf3b1	UTSW	1	55,038,814 (GRCm39)	missense	probably benign	0.01
R6531:Sf3b1	UTSW	1	55,058,554 (GRCm39)	missense	probably damaging	0.99
R6945:Sf3b1	UTSW	1	55,036,315 (GRCm39)	missense	probably benign	0.45
R7001:Sf3b1	UTSW	1	55,053,640 (GRCm39)	critical splice donor site	probably null
R7001:Sf3b1	UTSW	1	55,040,205 (GRCm39)	missense	probably damaging	0.96
R7302:Sf3b1	UTSW	1	55,055,949 (GRCm39)	missense	probably benign	0.00
R7644:Sf3b1	UTSW	1	55,036,302 (GRCm39)	nonsense	probably null
R7664:Sf3b1	UTSW	1	55,026,626 (GRCm39)	missense	probably damaging	1.00
R7735:Sf3b1	UTSW	1	55,042,508 (GRCm39)	missense	probably benign	0.29
R7809:Sf3b1	UTSW	1	55,034,614 (GRCm39)	missense	possibly damaging	0.60
R8516:Sf3b1	UTSW	1	55,051,262 (GRCm39)	missense	probably null	0.01
R8871:Sf3b1	UTSW	1	55,029,508 (GRCm39)	missense	probably damaging	1.00
R8947:Sf3b1	UTSW	1	55,039,444 (GRCm39)	missense	probably damaging	1.00
R9216:Sf3b1	UTSW	1	55,051,376 (GRCm39)	missense	probably benign	0.00
Z1177:Sf3b1	UTSW	1	55,042,561 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGGTCAGGAGATACATGTGTAGAT -3'

Posted On

2014-01-05