Mutagenetix > Incidental Mutation

Incidental Mutation 'R0991:Rd3'

97689

Institutional Source

Beutler Lab

Gene Symbol

Rd3

Ensembl Gene

ENSMUSG00000049353

Gene Name

retinal degeneration 3

Synonyms

3322402L07Rik, rd-3, rd3

MMRRC Submission

039111-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0991 (G1)

Quality Score

121

Status

Not validated

Chromosome

Chromosomal Location

191709331-191720244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 191717199 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 223 (E223G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000175680] [ENSMUST00000180463] [ENSMUST00000181512]

AlphaFold

Q8BRE0

Predicted Effect

probably damaging
Transcript: ENSMUST00000053463
AA Change: E223G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050188
Gene: ENSMUSG00000049353
AA Change: E223G

Domain	Start	End	E-Value	Type
Pfam:RD3	120	248	3.3e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175680
AA Change: S85G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000135650
Gene: ENSMUSG00000049353
AA Change: S85G

Domain	Start	End	E-Value	Type
Pfam:RD3	4	79	4.7e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180429

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180463
AA Change: E108G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138049
Gene: ENSMUSG00000049353
AA Change: E108G

Domain	Start	End	E-Value	Type
Pfam:RD3	4	134	2.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000181512
AA Change: S85G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000137756
Gene: ENSMUSG00000049353
AA Change: S85G

Domain	Start	End	E-Value	Type
Pfam:RD3	4	79	4.7e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226862

Coding Region Coverage

1x: 99.0%
3x: 97.4%
10x: 91.6%
20x: 77.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinal protein that is associated with promyelocytic leukemia-gene product (PML) bodies in the nucleus. Mutations in this gene cause Leber congenital amaurosis type 12, a disease that results in retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit retinal degeneration, beginning at 3 weeks of age, characterized by complete loss of photoreceptor rod cells by 5 weeks, and cones by 8 weeks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	A	18: 34,449,160 (GRCm39)	C1985S	probably damaging	Het
Atp8a2	T	C	14: 60,031,378 (GRCm39)	S899G	probably benign	Het
Dna2	C	T	10: 62,784,966 (GRCm39)	R28W	probably benign	Het
Dtwd1	G	A	2: 126,001,940 (GRCm39)	R220Q	probably damaging	Het
Edil3	A	T	13: 89,437,625 (GRCm39)	K409*	probably null	Het
Ltbp1	A	G	17: 75,532,280 (GRCm39)	Q118R	possibly damaging	Het
Mia	G	A	7: 26,880,145 (GRCm39)	R81C	probably damaging	Het
Pik3c2a	A	G	7: 115,961,280 (GRCm39)		probably null	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Sf3b1	C	G	1: 55,058,554 (GRCm39)	E12Q	possibly damaging	Het
Tenm2	C	T	11: 35,954,004 (GRCm39)	G1236R	possibly damaging	Het
Vmn1r65	G	A	7: 6,012,076 (GRCm39)	P53S	probably damaging	Het
Xrn2	A	G	2: 146,884,002 (GRCm39)	K587R	probably benign	Het

Other mutations in Rd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01520:Rd3	APN	1	191,717,283 (GRCm39)	missense	possibly damaging	0.84
IGL02319:Rd3	APN	1	191,715,452 (GRCm39)	missense	probably null	1.00
R0098:Rd3	UTSW	1	191,717,261 (GRCm39)	missense	probably benign	0.05
R0098:Rd3	UTSW	1	191,717,261 (GRCm39)	missense	probably benign	0.05
R0458:Rd3	UTSW	1	191,709,414 (GRCm39)	missense	probably damaging	0.96
R0537:Rd3	UTSW	1	191,715,501 (GRCm39)	missense	probably damaging	1.00
R1344:Rd3	UTSW	1	191,717,262 (GRCm39)	makesense	probably null
R2168:Rd3	UTSW	1	191,715,488 (GRCm39)	missense	probably damaging	0.97
R3898:Rd3	UTSW	1	191,717,217 (GRCm39)	missense	probably damaging	1.00
R3899:Rd3	UTSW	1	191,717,217 (GRCm39)	missense	probably damaging	1.00
R3900:Rd3	UTSW	1	191,717,217 (GRCm39)	missense	probably damaging	1.00
R5870:Rd3	UTSW	1	191,717,261 (GRCm39)	missense	probably benign	0.00
R8047:Rd3	UTSW	1	191,709,620 (GRCm39)	start gained	probably benign
R8506:Rd3	UTSW	1	191,715,228 (GRCm39)	start codon destroyed	probably null	0.98
R9541:Rd3	UTSW	1	191,717,294 (GRCm39)	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TCTCAGAGTAATCACAGGGGCAGG -3'
(R):5'- TGGTTCGGATGTCACTGGCAAAG -3'

Sequencing Primer
(F):5'- ccatgtgaaaaggcaggtg -3'
(R):5'- TCACTGGCAAAGGGTGC -3'

Posted On

2014-01-05