Incidental Mutation 'R0991:Dtwd1'
ID97690
Institutional Source Beutler Lab
Gene Symbol Dtwd1
Ensembl Gene ENSMUSG00000023330
Gene NameDTW domain containing 1
Synonyms
MMRRC Submission 039111-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0991 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126152141-126165279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126160020 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 220 (R220Q)
Ref Sequence ENSEMBL: ENSMUSP00000127662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110437] [ENSMUST00000170908]
Predicted Effect probably damaging
Transcript: ENSMUST00000110437
AA Change: R220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106067
Gene: ENSMUSG00000023330
AA Change: R220Q

DomainStartEndE-ValueType
DTW 65 293 2.33e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170908
AA Change: R220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127662
Gene: ENSMUSG00000023330
AA Change: R220Q

DomainStartEndE-ValueType
DTW 65 293 2.33e-58 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 91.6%
  • 20x: 77.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T A 18: 34,316,107 C1985S probably damaging Het
Atp8a2 T C 14: 59,793,929 S899G probably benign Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Edil3 A T 13: 89,289,506 K409* probably null Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mia G A 7: 27,180,720 R81C probably damaging Het
Pik3c2a A G 7: 116,362,045 probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rd3 A G 1: 191,985,238 E223G probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Vmn1r65 G A 7: 6,009,077 P53S probably damaging Het
Xrn2 A G 2: 147,042,082 K587R probably benign Het
Other mutations in Dtwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Dtwd1 APN 2 126164819 missense probably damaging 1.00
IGL01380:Dtwd1 APN 2 126159927 missense probably benign 0.25
IGL02097:Dtwd1 APN 2 126164795 missense probably damaging 1.00
R1103:Dtwd1 UTSW 2 126154723 missense probably damaging 1.00
R2145:Dtwd1 UTSW 2 126159984 missense probably damaging 1.00
R5249:Dtwd1 UTSW 2 126154774 missense probably benign
R5777:Dtwd1 UTSW 2 126159813 missense probably damaging 1.00
R5874:Dtwd1 UTSW 2 126158439 missense probably damaging 1.00
R5951:Dtwd1 UTSW 2 126158422 missense probably benign 0.36
R7261:Dtwd1 UTSW 2 126158504 missense probably benign 0.00
R7829:Dtwd1 UTSW 2 126164759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGAATCACAGGAGCGTAGCAC -3'
(R):5'- TTGAAAGGGTTCCTCCAGCGATG -3'

Sequencing Primer
(F):5'- GGGCCTCAGTCTATCTCAATAGAAG -3'
(R):5'- ggttcctccagcgatgtatatag -3'
Posted On2014-01-05