Incidental Mutation 'R1119:Ndufa9'
ID97716
Institutional Source Beutler Lab
Gene Symbol Ndufa9
Ensembl Gene ENSMUSG00000000399
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
Synonyms
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126821721-126849136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126822068 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 362 (L362Q)
Ref Sequence ENSEMBL: ENSMUSP00000144904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088194] [ENSMUST00000205002]
Predicted Effect probably damaging
Transcript: ENSMUST00000088194
AA Change: L358Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085523
Gene: ENSMUSG00000000399
AA Change: L358Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201350
Predicted Effect probably damaging
Transcript: ENSMUST00000205002
AA Change: L362Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144904
Gene: ENSMUSG00000000399
AA Change: L362Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Meta Mutation Damage Score 0.6208 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. A pseudogene has been identified on chromosome 12. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Ndufa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Ndufa9 APN 6 126844814 missense probably damaging 1.00
IGL02167:Ndufa9 APN 6 126844785 splice site probably benign
IGL02206:Ndufa9 APN 6 126844403 nonsense probably null
IGL03186:Ndufa9 APN 6 126844892 missense possibly damaging 0.47
IGL03356:Ndufa9 APN 6 126844850 missense possibly damaging 0.89
R0310:Ndufa9 UTSW 6 126827532 splice site probably benign
R1118:Ndufa9 UTSW 6 126822068 missense probably damaging 1.00
R1714:Ndufa9 UTSW 6 126822191 critical splice acceptor site probably null
R2207:Ndufa9 UTSW 6 126844809 missense probably damaging 1.00
R2483:Ndufa9 UTSW 6 126844399 missense possibly damaging 0.48
R3617:Ndufa9 UTSW 6 126849108 unclassified probably benign
R3623:Ndufa9 UTSW 6 126844399 missense possibly damaging 0.48
R4619:Ndufa9 UTSW 6 126827535 splice site probably null
R4855:Ndufa9 UTSW 6 126827542 nonsense probably null
R4931:Ndufa9 UTSW 6 126836320 missense probably damaging 1.00
R4965:Ndufa9 UTSW 6 126822063 missense probably benign 0.01
R5109:Ndufa9 UTSW 6 126832557 splice site probably null
R7373:Ndufa9 UTSW 6 126834458 missense probably damaging 1.00
Z1176:Ndufa9 UTSW 6 126844815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATGCAGCCTGAGATCATAGC -3'
(R):5'- AGAGATAGCTCCTGCCACGTTCAC -3'

Sequencing Primer
(F):5'- GGGCCTTGGTATAAGAATTCCAAAC -3'
(R):5'- TTGCCTCAGTGATGAGCC -3'
Posted On2014-01-05