Incidental Mutation 'R0991:Prl2c2'
ID97720
Institutional Source Beutler Lab
Gene Symbol Prl2c2
Ensembl Gene ENSMUSG00000079092
Gene Nameprolactin family 2, subfamily c, member 2
SynonymsPlf, Plf1, MRP-1, PLF-1
MMRRC Submission 039111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0991 (G1)
Quality Score198
Status Not validated
Chromosome13
Chromosomal Location12996125-13005383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13002201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 47 (T47R)
Ref Sequence ENSEMBL: ENSMUSP00000152538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110594] [ENSMUST00000220558] [ENSMUST00000221612] [ENSMUST00000221627]
Predicted Effect probably damaging
Transcript: ENSMUST00000110594
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106224
Gene: ENSMUSG00000079092
AA Change: T47R

DomainStartEndE-ValueType
Pfam:Hormone_1 16 224 9.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220558
AA Change: T45R

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000221612
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000221627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223124
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 91.6%
  • 20x: 77.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T A 18: 34,316,107 C1985S probably damaging Het
Atp8a2 T C 14: 59,793,929 S899G probably benign Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dtwd1 G A 2: 126,160,020 R220Q probably damaging Het
Edil3 A T 13: 89,289,506 K409* probably null Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mia G A 7: 27,180,720 R81C probably damaging Het
Pik3c2a A G 7: 116,362,045 probably null Het
Rd3 A G 1: 191,985,238 E223G probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Vmn1r65 G A 7: 6,009,077 P53S probably damaging Het
Xrn2 A G 2: 147,042,082 K587R probably benign Het
Other mutations in Prl2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Prl2c2 APN 13 13002243 missense probably damaging 1.00
R0993:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1139:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1196:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1250:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1319:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1321:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1325:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1341:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1382:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1415:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1494:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1878:Prl2c2 UTSW 13 13005326 start codon destroyed probably damaging 0.99
R1950:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1983:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1999:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R3704:Prl2c2 UTSW 13 13002225 missense probably damaging 0.99
R4972:Prl2c2 UTSW 13 13002170 missense possibly damaging 0.74
R6170:Prl2c2 UTSW 13 13002172 missense probably damaging 0.99
R6766:Prl2c2 UTSW 13 13002128 splice site probably null
R7426:Prl2c2 UTSW 13 12997480 splice site probably null
R7635:Prl2c2 UTSW 13 12997343 missense probably damaging 0.98
R7842:Prl2c2 UTSW 13 13005322 missense probably benign 0.13
X0065:Prl2c2 UTSW 13 13002175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTTTCTGCTTTAGGCTATGCACTA -3'
(R):5'- TCAGCACCCTGCCTTGAATCAAAT -3'

Sequencing Primer
(F):5'- CTATATCAACCATTGTGTTGGAGGC -3'
(R):5'- caaaacaaccaaccaaccaac -3'
Posted On2014-01-05