Incidental Mutation 'R1119:Hikeshi'
ID97734
Institutional Source Beutler Lab
Gene Symbol Hikeshi
Ensembl Gene ENSMUSG00000062797
Gene Nameheat shock protein nuclear import factor
Synonyms0610007P06Rik, Hikeshi, l(7)6Rn, 1110002N09Rik, l7Rn6
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89917529-89941204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89935730 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000147050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075010] [ENSMUST00000078918] [ENSMUST00000130609] [ENSMUST00000153470] [ENSMUST00000207309]
Predicted Effect probably benign
Transcript: ENSMUST00000075010
AA Change: S50P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102856
Gene: ENSMUSG00000062797
AA Change: S50P

DomainStartEndE-ValueType
Pfam:DUF775 1 156 5.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078918
AA Change: S89P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077951
Gene: ENSMUSG00000062797
AA Change: S89P

DomainStartEndE-ValueType
Pfam:DUF775 1 89 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130609
Predicted Effect probably benign
Transcript: ENSMUST00000153470
AA Change: S89P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119806
Gene: ENSMUSG00000062797
AA Change: S89P

DomainStartEndE-ValueType
Pfam:DUF775 1 195 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207309
AA Change: S89P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208357
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved nuclear transport receptor that mediates heat-shock-induced nuclear import of 70 kDa heat-shock proteins (Hsp70s) through interactions with FG-nucleoporins. The protein mediates transport of the ATP form but not the ADP form of Hsp70 proteins under conditions of heat shock stress. Structural analyses demonstrate that the protein forms an asymmetric homodimer and that the N-terminal domain consists of a jelly-roll/beta-sandwich fold structure that contains hydrophobic pockets involved in FG-nucleoporin recognition. Reduction of RNA expression levels in HeLa cells using small interfering RNAs results in inhibition of heat shock-induced nuclear accumulation of Hsp70s, indicating a role for this gene in regulation of Hsp70 nuclear import during heat shock stress. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation die prenatally or neonatally, and exhibit cyanoisis with a significant emphysematous phenotype at birth. The secretory apparatus in Clara cells is also affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Hikeshi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Hikeshi APN 7 89935781 missense probably damaging 0.99
IGL00502:Hikeshi APN 7 89923610 missense probably benign 0.34
IGL02296:Hikeshi APN 7 89935922 missense probably damaging 1.00
IGL02749:Hikeshi APN 7 89935889 missense possibly damaging 0.47
IGL03110:Hikeshi APN 7 89935826 missense probably damaging 1.00
R0023:Hikeshi UTSW 7 89920204 splice site probably benign
R0591:Hikeshi UTSW 7 89920087 missense possibly damaging 0.74
R4646:Hikeshi UTSW 7 89923646 missense probably damaging 1.00
R6799:Hikeshi UTSW 7 89930345 intron probably benign
R7694:Hikeshi UTSW 7 89930346 nonsense probably null
R7698:Hikeshi UTSW 7 89923681 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGTGCCCAAGCAGCTTTTACTTAC -3'
(R):5'- CATACTGGGGACAGTTTGTGGCAG -3'

Sequencing Primer
(F):5'- ACTTACACTTCTCAAATGCTACTG -3'
(R):5'- GGCAGTACTAAAGGTTTCAGTAACTC -3'
Posted On2014-01-05