Incidental Mutation 'R0992:Gdap1'
ID97745
Institutional Source Beutler Lab
Gene Symbol Gdap1
Ensembl Gene ENSMUSG00000025777
Gene Nameganglioside-induced differentiation-associated-protein 1
Synonyms
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location17145362-17164271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17147105 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 96 (Y96C)
Ref Sequence ENSEMBL: ENSMUSP00000026879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026879] [ENSMUST00000189736]
Predicted Effect probably damaging
Transcript: ENSMUST00000026879
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026879
Gene: ENSMUSG00000025777
AA Change: Y96C

DomainStartEndE-ValueType
Pfam:GST_N 24 99 2.8e-15 PFAM
Pfam:GST_N_3 28 105 8.1e-18 PFAM
Pfam:GST_N_2 33 100 2.7e-12 PFAM
Pfam:GST_C 148 287 3.5e-10 PFAM
Pfam:GST_C_2 160 282 5.8e-13 PFAM
Pfam:GST_C_3 164 285 8.5e-10 PFAM
transmembrane domain 292 309 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150457
Predicted Effect probably benign
Transcript: ENSMUST00000189736
SMART Domains Protein: ENSMUSP00000140406
Gene: ENSMUSG00000025777

DomainStartEndE-ValueType
SCOP:d1eema2 19 55 4e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ganglioside-induced differentiation-associated protein family, which may play a role in a signal transduction pathway during neuronal development. Mutations in this gene have been associated with various forms of Charcot-Marie-Tooth Disease and neuropathy. Two transcript variants encoding different isoforms and a noncoding variant have been identified for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele develop motor deficits and a peripheral neuropathy with loss of motor neurons and abnormal neuromuscular junctions. Cultured motor neurons show large and abnormal mitochondria, reduced axon length, changes in the ER cisternae, and altered calcium ion homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Gdap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02424:Gdap1 APN 1 17161178 missense probably damaging 1.00
IGL02570:Gdap1 APN 1 17145485 missense probably benign 0.27
IGL03269:Gdap1 APN 1 17161505 missense probably benign 0.00
R1480:Gdap1 UTSW 1 17145557 missense probably damaging 1.00
R1518:Gdap1 UTSW 1 17146945 missense possibly damaging 0.54
R2061:Gdap1 UTSW 1 17145465 unclassified probably benign
R3983:Gdap1 UTSW 1 17159907 intron probably benign
R4892:Gdap1 UTSW 1 17159994 missense possibly damaging 0.61
R5765:Gdap1 UTSW 1 17161426 missense probably benign
R6471:Gdap1 UTSW 1 17160025 missense possibly damaging 0.50
R7574:Gdap1 UTSW 1 17161441 missense possibly damaging 0.59
R7689:Gdap1 UTSW 1 17161399 missense probably damaging 1.00
R7895:Gdap1 UTSW 1 17161144 missense probably damaging 1.00
R7937:Gdap1 UTSW 1 17159953 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGGTGAGAACAGCAGTAACCCCTG -3'
(R):5'- TCAGCAGAAAGAAGCATTTGCACAC -3'

Sequencing Primer
(F):5'- AGTGAGCACAATGAGCCTTG -3'
(R):5'- GACAAATGGTCCTTCTCTAGCATTG -3'
Posted On2014-01-05