Incidental Mutation 'R0992:Sla2'
ID97753
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0992 (G1)
Quality Score96
Status Not validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156874472 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 243 (E243G)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000029165] [ENSMUST00000109561]
Predicted Effect probably damaging
Transcript: ENSMUST00000029164
AA Change: E243G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: E243G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029165
SMART Domains Protein: ENSMUSP00000029165
Gene: ENSMUSG00000027637

DomainStartEndE-ValueType
Pfam:Rab5ip 44 123 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109561
AA Change: E243G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: E243G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152551
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2377:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2379:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2442:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3499:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R6784:Sla2 UTSW 2 156883669 missense unknown
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGCACTGCACATGGACTAGAAG -3'
(R):5'- ACAATGGGGCTGTCACATTCAGGG -3'

Sequencing Primer
(F):5'- TGACTTATCAGAAAGCCCAGGTG -3'
(R):5'- TCACAGTCCTGCATAGGGAG -3'
Posted On2014-01-05