Mutagenetix > Incidental Mutations

Incidental Mutation 'R0992:Col15a1'

97757

Institutional Source

Beutler Lab

Gene Symbol

Col15a1

Ensembl Gene

ENSMUSG00000028339

Gene Name

collagen, type XV, alpha 1

Synonyms

MMRRC Submission

039112-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47208161-47313167 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47300491 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1029 (V1029M)

Ref Sequence

ENSEMBL: ENSMUSP00000080921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917] [ENSMUST00000107730] [ENSMUST00000107731] [ENSMUST00000146967]

Predicted Effect

probably damaging
Transcript: ENSMUST00000082303
AA Change: V1029M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: V1029M

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSPN	40	228	2.53e-56	SMART
LamG	89	227	1.7e-7	SMART
low complexity region	236	251	N/A	INTRINSIC
low complexity region	332	344	N/A	INTRINSIC
low complexity region	541	567	N/A	INTRINSIC
Pfam:Collagen	603	663	1.4e-10	PFAM
Pfam:Collagen	650	719	2.1e-9	PFAM
low complexity region	722	742	N/A	INTRINSIC
low complexity region	750	759	N/A	INTRINSIC
Pfam:Collagen	782	832	2.7e-10	PFAM
Pfam:Collagen	838	894	5.1e-10	PFAM
low complexity region	965	980	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
Pfam:Endostatin	1087	1164	9.3e-15	PFAM
Pfam:Endostatin	1148	1345	1.4e-97	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102917
AA Change: V1051M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: V1051M

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSPN	40	228	2.53e-56	SMART
LamG	89	227	1.7e-7	SMART
low complexity region	236	251	N/A	INTRINSIC
low complexity region	332	344	N/A	INTRINSIC
low complexity region	541	567	N/A	INTRINSIC
Pfam:Collagen	603	666	5.6e-10	PFAM
Pfam:Collagen	659	720	3.1e-10	PFAM
low complexity region	737	764	N/A	INTRINSIC
low complexity region	772	781	N/A	INTRINSIC
Pfam:Collagen	804	854	9.5e-10	PFAM
Pfam:Collagen	860	916	1.8e-9	PFAM
low complexity region	987	1002	N/A	INTRINSIC
low complexity region	1032	1042	N/A	INTRINSIC
low complexity region	1050	1109	N/A	INTRINSIC
Pfam:Endostatin	1112	1362	2.8e-102	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107730

SMART Domains

Protein: ENSMUSP00000103358
Gene: ENSMUSG00000028339

Domain	Start	End	E-Value	Type
Pfam:Endostatin	20	100	8.7e-16	PFAM
Pfam:Endostatin	83	278	5.7e-99	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107731
AA Change: V217M

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103359
Gene: ENSMUSG00000028339
AA Change: V217M

Domain	Start	End	E-Value	Type
Pfam:Collagen	6	81	6.5e-9	PFAM
Pfam:Collagen	48	102	3.8e-8	PFAM
low complexity region	153	168	N/A	INTRINSIC
Pfam:Collagen	196	258	4.1e-8	PFAM
Pfam:Endostatin	275	355	2.5e-15	PFAM
Pfam:Endostatin	336	533	2.8e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146967

SMART Domains

Protein: ENSMUSP00000118637
Gene: ENSMUSG00000028339

Domain	Start	End	E-Value	Type
Pfam:Collagen	2	55	6.3e-11	PFAM
Pfam:Collagen	96	141	2.9e-7	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,211,684	T905A	probably damaging	Het
Arhgap20	A	G	9: 51,816,786	R100G	probably damaging	Het
Bsn	G	A	9: 108,114,354	R1400*	probably null	Het
Clstn2	A	G	9: 97,445,712	S948P	probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disc1	T	C	8: 125,088,042	I215T	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dst	A	G	1: 34,199,536	N3773S	probably damaging	Het
Gdap1	A	G	1: 17,147,105	Y96C	probably damaging	Het
Glipr1l1	A	G	10: 112,062,325	R112G	probably benign	Het
Gria4	A	G	9: 4,795,238	S13P	probably benign	Het
Noxred1	T	C	12: 87,224,226	N207S	probably benign	Het
Pom121l2	A	T	13: 21,982,759	Q400L	probably benign	Het
Sla2	T	C	2: 156,874,472	E243G	probably damaging	Het
Srpk2	A	G	5: 23,545,543	I54T	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Trim15	C	T	17: 36,865,011	V215M	probably damaging	Het
Uchl3	T	C	14: 101,668,533	I144T	probably benign	Het

Other mutations in Col15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Col15a1	APN	4	47208450	missense	possibly damaging	0.86
IGL01561:Col15a1	APN	4	47312118	missense	possibly damaging	0.87
IGL01750:Col15a1	APN	4	47303897	missense	probably damaging	1.00
IGL02112:Col15a1	APN	4	47253985	splice site	probably benign
IGL02158:Col15a1	APN	4	47300606	splice site	probably null
IGL02268:Col15a1	APN	4	47245380	missense	probably damaging	0.99
IGL02325:Col15a1	APN	4	47289364	missense	probably damaging	1.00
IGL02583:Col15a1	APN	4	47279866	missense	probably benign	0.00
IGL02699:Col15a1	APN	4	47284471	unclassified	probably benign
IGL03167:Col15a1	APN	4	47282635	missense	probably damaging	0.99
IGL03174:Col15a1	APN	4	47282666	missense	probably damaging	0.99
R0119:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0299:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0499:Col15a1	UTSW	4	47262950	missense	probably damaging	0.98
R0567:Col15a1	UTSW	4	47293231	missense	possibly damaging	0.89
R0607:Col15a1	UTSW	4	47282654	missense	probably damaging	0.99
R1165:Col15a1	UTSW	4	47257275	splice site	probably benign
R1191:Col15a1	UTSW	4	47254083	nonsense	probably null
R1852:Col15a1	UTSW	4	47299278	critical splice donor site	probably null
R2349:Col15a1	UTSW	4	47306742	missense	probably damaging	0.99
R2512:Col15a1	UTSW	4	47245868	missense	possibly damaging	0.95
R2517:Col15a1	UTSW	4	47208492	missense	probably damaging	0.98
R2895:Col15a1	UTSW	4	47312091	missense	possibly damaging	0.59
R3688:Col15a1	UTSW	4	47258689	missense	probably benign	0.00
R3848:Col15a1	UTSW	4	47289374	missense	possibly damaging	0.73
R4430:Col15a1	UTSW	4	47245705	missense	probably damaging	1.00
R4587:Col15a1	UTSW	4	47257184	missense	probably damaging	1.00
R4793:Col15a1	UTSW	4	47262997	missense	possibly damaging	0.83
R4812:Col15a1	UTSW	4	47262479	missense	possibly damaging	0.93
R4922:Col15a1	UTSW	4	47258719	missense	probably benign
R5233:Col15a1	UTSW	4	47296112	missense	possibly damaging	0.74
R5602:Col15a1	UTSW	4	47312087	missense	probably damaging	1.00
R5786:Col15a1	UTSW	4	47280865	missense	possibly damaging	0.84
R5910:Col15a1	UTSW	4	47289514	missense	probably damaging	1.00
R5921:Col15a1	UTSW	4	47300602	missense	probably damaging	0.99
R5974:Col15a1	UTSW	4	47258683	missense	probably benign	0.02
R5985:Col15a1	UTSW	4	47284507	missense	probably damaging	0.99
R6010:Col15a1	UTSW	4	47245630	missense	probably benign	0.03
R6720:Col15a1	UTSW	4	47247552	critical splice donor site	probably null
R6791:Col15a1	UTSW	4	47300518	missense	probably damaging	1.00
R6855:Col15a1	UTSW	4	47245544	missense	probably damaging	1.00
R6965:Col15a1	UTSW	4	47247533	missense	probably damaging	0.96
R7201:Col15a1	UTSW	4	47307752	missense	possibly damaging	0.92
R7261:Col15a1	UTSW	4	47269088	missense	probably benign	0.03
R7273:Col15a1	UTSW	4	47284467	splice site	probably null
R7413:Col15a1	UTSW	4	47245431	missense	possibly damaging	0.81
R7658:Col15a1	UTSW	4	47245591	missense	possibly damaging	0.46
R8032:Col15a1	UTSW	4	47288108	missense	unknown
R8075:Col15a1	UTSW	4	47208359	missense	probably benign	0.07
R8130:Col15a1	UTSW	4	47312196	missense	probably damaging	0.97
R8536:Col15a1	UTSW	4	47208536	critical splice donor site	probably null
Z1177:Col15a1	UTSW	4	47245807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAGGCAAGCCCTCTCCATTCTG -3'
(R):5'- AATGTGCTACCCTGAGCCCAAAG -3'

Sequencing Primer
(F):5'- gccctctccattctgaggac -3'
(R):5'- CCTGAGCCCAAAGGCAGAG -3'

Posted On

2014-01-05