Incidental Mutation 'R1119:Zfp62'
ID97762
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Namezinc finger protein 62
Synonyms
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49203292-49218816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49216690 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 536 (R536L)
Ref Sequence ENSEMBL: ENSMUSP00000116045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
Predicted Effect probably damaging
Transcript: ENSMUST00000061757
AA Change: R536L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: R536L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109197
AA Change: R536L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: R536L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109198
AA Change: R536L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: R536L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128932
Predicted Effect probably benign
Transcript: ENSMUST00000133150
Predicted Effect probably damaging
Transcript: ENSMUST00000136539
AA Change: R536L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: R536L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136691
Predicted Effect probably benign
Transcript: ENSMUST00000137061
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157023
Predicted Effect probably damaging
Transcript: ENSMUST00000180016
AA Change: R536L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: R536L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49215471 nonsense probably null
R0416:Zfp62 UTSW 11 49215676 missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49215400 missense probably benign
R0607:Zfp62 UTSW 11 49215400 missense probably benign
R1230:Zfp62 UTSW 11 49215099 missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49215769 missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49217683 missense probably benign
R1840:Zfp62 UTSW 11 49216388 missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49216220 missense probably damaging 0.99
R3878:Zfp62 UTSW 11 49215133 missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49215741 missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49215742 missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49216272 missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49217805 makesense probably null
R5022:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5023:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49217148 missense probably damaging 0.98
R5362:Zfp62 UTSW 11 49216612 missense probably damaging 1.00
R5685:Zfp62 UTSW 11 49216217 nonsense probably null
R6420:Zfp62 UTSW 11 49216513 missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49215169 missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49216379 nonsense probably null
R7016:Zfp62 UTSW 11 49215937 missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49216753 missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49215076 start gained probably benign
R7675:Zfp62 UTSW 11 49216020 missense possibly damaging 0.75
R7686:Zfp62 UTSW 11 49217158 missense probably damaging 1.00
X0011:Zfp62 UTSW 11 49215598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTATATCTCACGCTCAagcct -3'
(R):5'- GGCTTTTCCCCAAGATGGACTCTC -3'

Sequencing Primer
(F):5'- ccttaaaaatcacaaaggaatccac -3'
(R):5'- tgtgttgagaaaggagtgagg -3'
Posted On2014-01-05