Mutagenetix > Incidental Mutations

Incidental Mutation 'R0992:Gria4'

97773

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

039112-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.805) question?

Stock #

R0992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4795238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 13 (S13P)

Ref Sequence

ENSEMBL: ENSMUSP00000148533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: S13P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: S13P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: S13P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: S13P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163309
AA Change: S13P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: S13P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: S13P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,211,684	T905A	probably damaging	Het
Arhgap20	A	G	9: 51,816,786	R100G	probably damaging	Het
Bsn	G	A	9: 108,114,354	R1400*	probably null	Het
Clstn2	A	G	9: 97,445,712	S948P	probably benign	Het
Col15a1	G	A	4: 47,300,491	V1029M	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disc1	T	C	8: 125,088,042	I215T	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dst	A	G	1: 34,199,536	N3773S	probably damaging	Het
Gdap1	A	G	1: 17,147,105	Y96C	probably damaging	Het
Glipr1l1	A	G	10: 112,062,325	R112G	probably benign	Het
Noxred1	T	C	12: 87,224,226	N207S	probably benign	Het
Pom121l2	A	T	13: 21,982,759	Q400L	probably benign	Het
Sla2	T	C	2: 156,874,472	E243G	probably damaging	Het
Srpk2	A	G	5: 23,545,543	I54T	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Trim15	C	T	17: 36,865,011	V215M	probably damaging	Het
Uchl3	T	C	14: 101,668,533	I144T	probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGCCTGAACTTGCACCCAGAAG -3'
(R):5'- GCTATGGAGACTGCGGGAAACATC -3'

Sequencing Primer
(F):5'- GCACCCAGAAGGTCTGTTTG -3'
(R):5'- Ttctctctctctctctctctctctc -3'

Posted On

2014-01-05