Incidental Mutation 'R0992:Clstn2'
ID97779
Institutional Source Beutler Lab
Gene Symbol Clstn2
Ensembl Gene ENSMUSG00000032452
Gene Namecalsyntenin 2
SynonymsCst-2, CSTN2, CS2, 2900042C18Rik
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location97444395-98033181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97445712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 948 (S948P)
Ref Sequence ENSEMBL: ENSMUSP00000035027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035027]
Predicted Effect probably benign
Transcript: ENSMUST00000035027
AA Change: S948P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: S948P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
SCOP:d1a8d_1 358 538 5e-21 SMART
Blast:LamG 380 529 3e-41 BLAST
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Clstn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Clstn2 APN 9 97582452 splice site probably benign
IGL00563:Clstn2 APN 9 97582452 splice site probably benign
IGL00733:Clstn2 APN 9 97483049 missense probably damaging 1.00
IGL01303:Clstn2 APN 9 97483075 nonsense probably null
IGL01935:Clstn2 APN 9 97463468 missense probably damaging 1.00
IGL02157:Clstn2 APN 9 97541875 missense probably benign
IGL02974:Clstn2 APN 9 97532707 missense probably damaging 1.00
IGL03164:Clstn2 APN 9 97799409 missense possibly damaging 0.50
IGL03298:Clstn2 APN 9 97456572 missense probably damaging 1.00
R0653:Clstn2 UTSW 9 97458204 missense probably damaging 1.00
R0845:Clstn2 UTSW 9 97570628 missense probably benign 0.39
R1105:Clstn2 UTSW 9 97583499 splice site probably null
R1112:Clstn2 UTSW 9 97458228 missense possibly damaging 0.92
R1264:Clstn2 UTSW 9 97457609 missense probably benign 0.28
R1275:Clstn2 UTSW 9 97457430 missense probably benign 0.00
R1329:Clstn2 UTSW 9 97458174 missense probably damaging 1.00
R1396:Clstn2 UTSW 9 97461393 missense probably benign 0.02
R1556:Clstn2 UTSW 9 97456505 missense probably benign 0.41
R1703:Clstn2 UTSW 9 97458237 missense possibly damaging 0.90
R1837:Clstn2 UTSW 9 97583540 missense probably benign 0.00
R2911:Clstn2 UTSW 9 97532722 missense probably damaging 1.00
R3434:Clstn2 UTSW 9 97454715 missense probably benign 0.17
R3771:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3772:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3854:Clstn2 UTSW 9 97463595 nonsense probably null
R4049:Clstn2 UTSW 9 97457560 missense possibly damaging 0.59
R4334:Clstn2 UTSW 9 97463528 missense probably damaging 1.00
R4705:Clstn2 UTSW 9 97463559 missense possibly damaging 0.95
R4755:Clstn2 UTSW 9 97445673 missense probably benign 0.01
R4884:Clstn2 UTSW 9 97799395 missense probably damaging 1.00
R5017:Clstn2 UTSW 9 97483086 missense probably damaging 1.00
R5076:Clstn2 UTSW 9 97483079 missense probably damaging 1.00
R5122:Clstn2 UTSW 9 97461421 missense probably damaging 1.00
R5155:Clstn2 UTSW 9 97456431 missense probably benign 0.02
R5560:Clstn2 UTSW 9 97469819 missense possibly damaging 0.95
R6009:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6011:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6029:Clstn2 UTSW 9 97456581 missense probably benign 0.00
R6093:Clstn2 UTSW 9 97458210 missense probably damaging 1.00
R6284:Clstn2 UTSW 9 97454674 missense probably benign
R6676:Clstn2 UTSW 9 97461531 missense probably damaging 1.00
R6902:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6946:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6966:Clstn2 UTSW 9 97526406 nonsense probably null
R7329:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7330:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7382:Clstn2 UTSW 9 97799398 nonsense probably null
R7410:Clstn2 UTSW 9 97541867 missense probably benign 0.06
R7549:Clstn2 UTSW 9 97582544 missense probably benign 0.01
R7879:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R8070:Clstn2 UTSW 9 97799470 missense possibly damaging 0.79
R8193:Clstn2 UTSW 9 97583630 missense probably damaging 1.00
R8422:Clstn2 UTSW 9 97458186 missense probably benign 0.39
X0027:Clstn2 UTSW 9 97526399 missense probably damaging 1.00
Z1177:Clstn2 UTSW 9 97461356 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTCTGCCACTGTCTGACTACTG -3'
(R):5'- AGTTGTTCCCAAGGAAACCTGTAGC -3'

Sequencing Primer
(F):5'- CTGTCTGACTACTGCACAGAATATG -3'
(R):5'- CTACTAGAACGGGCCTTGTAACG -3'
Posted On2014-01-05