Incidental Mutation 'R1119:Aoah'
ID97780
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Nameacyloxyacyl hydrolase
Synonyms
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location20794113-21036617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 20914938 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757]
Predicted Effect probably benign
Transcript: ENSMUST00000021757
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
PIT4402001:Aoah UTSW 13 20794510 missense probably benign 0.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1036:Aoah UTSW 13 20840169 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 splice site probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R5853:Aoah UTSW 13 20999902 missense probably benign 0.01
R6134:Aoah UTSW 13 20911123 missense probably damaging 1.00
R6459:Aoah UTSW 13 20999942 missense probably damaging 0.99
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
R8198:Aoah UTSW 13 20917120 missense probably damaging 1.00
R8340:Aoah UTSW 13 20999942 missense probably damaging 0.99
R8723:Aoah UTSW 13 21000010 missense possibly damaging 0.81
R8790:Aoah UTSW 13 20851670 missense probably benign 0.16
R8811:Aoah UTSW 13 20999951 missense probably damaging 1.00
R8873:Aoah UTSW 13 20905682 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGAAGCACTGGGTCTCATC -3'
(R):5'- TTCCAGTCCCCAAGTGAAAGAGCC -3'

Sequencing Primer
(F):5'- AAGCACTGGGTCTCATCTGTTATC -3'
(R):5'- GGTTCTTTAACTGCTAACCTCAAAC -3'
Posted On2014-01-05