Incidental Mutation 'R0992:Glipr1l1'
ID97787
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene NameGLI pathogenesis-related 1 like 1
Synonyms1700011E04Rik
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112060189-112078510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112062325 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 112 (R112G)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
Predicted Effect probably benign
Transcript: ENSMUST00000073617
AA Change: R112G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: R112G

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0987:Glipr1l1 UTSW 10 112078435 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 112062338 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 112076170 missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
R8171:Glipr1l1 UTSW 10 112078384 missense probably benign 0.01
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 112078390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTAACCATGCCTGTCCCCTCTG -3'
(R):5'- TGTGTGAAGACCAAGGCACCTG -3'

Sequencing Primer
(F):5'- CCCTCTGAAATGGTGTTTCAAG -3'
(R):5'- GGCCACACATTTCAGAACAG -3'
Posted On2014-01-05