Incidental Mutation 'R1119:Atf7ip2'
ID97790
Institutional Source Beutler Lab
Gene Symbol Atf7ip2
Ensembl Gene ENSMUSG00000039200
Gene Nameactivating transcription factor 7 interacting protein 2
Synonyms4930558K11Rik, PSM2, Get-1
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10192712-10251478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10240612 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 305 (K305R)
Ref Sequence ENSEMBL: ENSMUSP00000113573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044005] [ENSMUST00000117220] [ENSMUST00000119023] [ENSMUST00000230872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044005
AA Change: K305R

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200
AA Change: K305R

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117220
AA Change: K305R

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113573
Gene: ENSMUSG00000039200
AA Change: K305R

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119023
SMART Domains Protein: ENSMUSP00000113480
Gene: ENSMUSG00000039200

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229819
Predicted Effect probably benign
Transcript: ENSMUST00000230872
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Atf7ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Atf7ip2 APN 16 10241885 missense probably damaging 0.99
IGL01937:Atf7ip2 APN 16 10241537 splice site probably null
IGL02301:Atf7ip2 APN 16 10211047 missense probably benign 0.32
R0575:Atf7ip2 UTSW 16 10237211 missense probably damaging 1.00
R0671:Atf7ip2 UTSW 16 10241879 missense possibly damaging 0.86
R1182:Atf7ip2 UTSW 16 10241835 missense possibly damaging 0.93
R1302:Atf7ip2 UTSW 16 10240608 missense possibly damaging 0.84
R1346:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1349:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1372:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1672:Atf7ip2 UTSW 16 10209141 missense probably damaging 1.00
R1696:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1897:Atf7ip2 UTSW 16 10211084 missense probably damaging 0.97
R1932:Atf7ip2 UTSW 16 10241703 missense possibly damaging 0.86
R2143:Atf7ip2 UTSW 16 10240645 missense probably null 0.68
R4612:Atf7ip2 UTSW 16 10241563 missense probably benign 0.33
R4732:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4733:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4934:Atf7ip2 UTSW 16 10241583 missense possibly damaging 0.72
R6137:Atf7ip2 UTSW 16 10201411 missense probably damaging 0.99
R6432:Atf7ip2 UTSW 16 10204670 missense probably damaging 1.00
R7298:Atf7ip2 UTSW 16 10209168 missense possibly damaging 0.82
R7517:Atf7ip2 UTSW 16 10241535 splice site probably null
R7744:Atf7ip2 UTSW 16 10241658 missense possibly damaging 0.93
U24488:Atf7ip2 UTSW 16 10204673 missense probably damaging 0.96
X0062:Atf7ip2 UTSW 16 10209274 splice site probably null
Z1177:Atf7ip2 UTSW 16 10241640 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CCTCAGGAGAGAGTTACCCCAGC -3'
(R):5'- TGAAAAGCCATTTTGGTGTTTCCTAAGC -3'

Sequencing Primer
(F):5'- AGAGAGTTACCCCAGCTTGTG -3'
(R):5'- TCCTAAGCTGAAATGTGGCTC -3'
Posted On2014-01-05