Incidental Mutation 'R0992:Noxred1'
ID97793
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene NameNADP+ dependent oxidoreductase domain containing 1
Synonyms
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0992 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87221040-87238732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87224226 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 207 (N207S)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
Predicted Effect probably benign
Transcript: ENSMUST00000021423
AA Change: N207S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: N207S

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221768
Predicted Effect probably benign
Transcript: ENSMUST00000222480
AA Change: N207S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87223181 missense probably benign 0.05
IGL01950:Noxred1 APN 12 87221416 missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87225002 missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87233438 missense probably damaging 1.00
PIT4402001:Noxred1 UTSW 12 87227081 missense probably benign 0.00
PIT4504001:Noxred1 UTSW 12 87224879 missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0514:Noxred1 UTSW 12 87227064 missense probably benign 0.01
R1626:Noxred1 UTSW 12 87221255 makesense probably null
R2370:Noxred1 UTSW 12 87227046 missense probably benign 0.00
R3692:Noxred1 UTSW 12 87233466 missense probably benign 0.26
R4084:Noxred1 UTSW 12 87233484 missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87224202 missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87227036 missense probably benign 0.00
R6977:Noxred1 UTSW 12 87221317 missense probably null 0.00
R7388:Noxred1 UTSW 12 87227025 missense probably damaging 0.99
R7535:Noxred1 UTSW 12 87233432 missense probably benign 0.00
R7737:Noxred1 UTSW 12 87221362 nonsense probably null
R7877:Noxred1 UTSW 12 87224987 missense probably benign 0.34
R7939:Noxred1 UTSW 12 87221331 missense probably benign 0.00
Z1176:Noxred1 UTSW 12 87223057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTCCATTCTGCCCAACAAAGG -3'
(R):5'- TGCATCTAGCCAAGAGCTAGGCAC -3'

Sequencing Primer
(F):5'- catacacacacacacacacac -3'
(R):5'- ATCTAATCAGTGCCCTGAGCG -3'
Posted On2014-01-05