Mutagenetix > Incidental Mutations

Incidental Mutation 'R0992:Noxred1'

97793

Institutional Source

Beutler Lab

Gene Symbol

Noxred1

Ensembl Gene

ENSMUSG00000072919

Gene Name

NADP+ dependent oxidoreductase domain containing 1

Synonyms

MMRRC Submission

039112-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R0992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87221040-87238732 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87224226 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 207 (N207S)

Ref Sequence

ENSEMBL: ENSMUSP00000152486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]

Predicted Effect

probably benign
Transcript: ENSMUST00000021423
AA Change: N207S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: N207S

Domain	Start	End	E-Value	Type
Pfam:F420_oxidored	80	173	1.1e-9	PFAM
low complexity region	261	269	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221768

Predicted Effect

probably benign
Transcript: ENSMUST00000222480
AA Change: N207S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,211,684	T905A	probably damaging	Het
Arhgap20	A	G	9: 51,816,786	R100G	probably damaging	Het
Bsn	G	A	9: 108,114,354	R1400*	probably null	Het
Clstn2	A	G	9: 97,445,712	S948P	probably benign	Het
Col15a1	G	A	4: 47,300,491	V1029M	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disc1	T	C	8: 125,088,042	I215T	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dst	A	G	1: 34,199,536	N3773S	probably damaging	Het
Gdap1	A	G	1: 17,147,105	Y96C	probably damaging	Het
Glipr1l1	A	G	10: 112,062,325	R112G	probably benign	Het
Gria4	A	G	9: 4,795,238	S13P	probably benign	Het
Pom121l2	A	T	13: 21,982,759	Q400L	probably benign	Het
Sla2	T	C	2: 156,874,472	E243G	probably damaging	Het
Srpk2	A	G	5: 23,545,543	I54T	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Trim15	C	T	17: 36,865,011	V215M	probably damaging	Het
Uchl3	T	C	14: 101,668,533	I144T	probably benign	Het

Other mutations in Noxred1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01943:Noxred1	APN	12	87223181	missense	probably benign	0.05
IGL01950:Noxred1	APN	12	87221416	missense	probably damaging	1.00
IGL02381:Noxred1	APN	12	87225002	missense	probably damaging	0.98
IGL03109:Noxred1	APN	12	87233438	missense	probably damaging	1.00
PIT4402001:Noxred1	UTSW	12	87227081	missense	probably benign	0.00
PIT4504001:Noxred1	UTSW	12	87224879	missense	possibly damaging	0.89
R0242:Noxred1	UTSW	12	87226979	missense	probably benign	0.02
R0242:Noxred1	UTSW	12	87226979	missense	probably benign	0.02
R0514:Noxred1	UTSW	12	87227064	missense	probably benign	0.01
R1626:Noxred1	UTSW	12	87221255	makesense	probably null
R2370:Noxred1	UTSW	12	87227046	missense	probably benign	0.00
R3692:Noxred1	UTSW	12	87233466	missense	probably benign	0.26
R4084:Noxred1	UTSW	12	87233484	missense	possibly damaging	0.67
R5868:Noxred1	UTSW	12	87224202	missense	possibly damaging	0.54
R6856:Noxred1	UTSW	12	87227036	missense	probably benign	0.00
R6977:Noxred1	UTSW	12	87221317	missense	probably null	0.00
R7388:Noxred1	UTSW	12	87227025	missense	probably damaging	0.99
R7535:Noxred1	UTSW	12	87233432	missense	probably benign	0.00
R7737:Noxred1	UTSW	12	87221362	nonsense	probably null
R7877:Noxred1	UTSW	12	87224987	missense	probably benign	0.34
R7939:Noxred1	UTSW	12	87221331	missense	probably benign	0.00
Z1176:Noxred1	UTSW	12	87223057	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACTCCATTCTGCCCAACAAAGG -3'
(R):5'- TGCATCTAGCCAAGAGCTAGGCAC -3'

Sequencing Primer
(F):5'- catacacacacacacacacac -3'
(R):5'- ATCTAATCAGTGCCCTGAGCG -3'

Posted On

2014-01-05