Incidental Mutation 'R1119:Gsk3b'
ID97794
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 38207984 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
Predicted Effect probably benign
Transcript: ENSMUST00000023507
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114750
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184976
Predicted Effect probably benign
Transcript: ENSMUST00000231437
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pcnp A G 16: 56,024,391 S49P probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
PIT4585001:Gsk3b UTSW 16 38184454 missense probably damaging 1.00
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1118:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 intron probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5134:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5726:Gsk3b UTSW 16 38208136 intron probably benign
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATGTCAGTCCCTGGAATCTTGCC -3'
(R):5'- TGAGCCACCTTCACAGAGAACTGC -3'

Sequencing Primer
(F):5'- ccctggaatcttgccctagtAATG -3'
(R):5'- GAGAACTGCTGAGTTTGTAATTGAC -3'
Posted On2014-01-05