Mutagenetix > Incidental Mutations

Incidental Mutation 'R0992:Pom121l2'

97799

Institutional Source

Beutler Lab

Gene Symbol

Pom121l2

Ensembl Gene

ENSMUSG00000016982

Gene Name

POM121 membrane glycoprotein-like 2 (rat)

Synonyms

LOC195236

MMRRC Submission

039112-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R0992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21981194-21988734 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21982759 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 400 (Q400L)

Ref Sequence

ENSEMBL: ENSMUSP00000017126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017126] [ENSMUST00000117882]

Predicted Effect

probably benign
Transcript: ENSMUST00000017126
AA Change: Q400L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000017126
Gene: ENSMUSG00000016982
AA Change: Q400L

Domain	Start	End	E-Value	Type
low complexity region	42	60	N/A	INTRINSIC
Pfam:POM121	162	301	3.5e-24	PFAM
low complexity region	367	379	N/A	INTRINSIC
low complexity region	413	433	N/A	INTRINSIC
low complexity region	517	526	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
low complexity region	697	712	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117882
AA Change: Q400L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113688
Gene: ENSMUSG00000016982
AA Change: Q400L

Domain	Start	End	E-Value	Type
low complexity region	42	60	N/A	INTRINSIC
Pfam:POM121	162	301	2e-24	PFAM
low complexity region	367	379	N/A	INTRINSIC
low complexity region	413	433	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,211,684	T905A	probably damaging	Het
Arhgap20	A	G	9: 51,816,786	R100G	probably damaging	Het
Bsn	G	A	9: 108,114,354	R1400*	probably null	Het
Clstn2	A	G	9: 97,445,712	S948P	probably benign	Het
Col15a1	G	A	4: 47,300,491	V1029M	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Disc1	T	C	8: 125,088,042	I215T	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dst	A	G	1: 34,199,536	N3773S	probably damaging	Het
Gdap1	A	G	1: 17,147,105	Y96C	probably damaging	Het
Glipr1l1	A	G	10: 112,062,325	R112G	probably benign	Het
Gria4	A	G	9: 4,795,238	S13P	probably benign	Het
Noxred1	T	C	12: 87,224,226	N207S	probably benign	Het
Sla2	T	C	2: 156,874,472	E243G	probably damaging	Het
Srpk2	A	G	5: 23,545,543	I54T	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Trim15	C	T	17: 36,865,011	V215M	probably damaging	Het
Uchl3	T	C	14: 101,668,533	I144T	probably benign	Het

Other mutations in Pom121l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02104:Pom121l2	APN	13	21982275	missense	possibly damaging	0.70
IGL02223:Pom121l2	APN	13	21982095	missense	probably benign	0.01
R0401:Pom121l2	UTSW	13	21982225	missense	probably benign	0.01
R0402:Pom121l2	UTSW	13	21988479	splice site	probably benign
R0437:Pom121l2	UTSW	13	21983205	missense	possibly damaging	0.72
R0575:Pom121l2	UTSW	13	21984168	missense	probably damaging	0.99
R0605:Pom121l2	UTSW	13	21982036	missense	probably damaging	1.00
R0892:Pom121l2	UTSW	13	21982474	missense	possibly damaging	0.49
R1259:Pom121l2	UTSW	13	21982127	nonsense	probably null
R1564:Pom121l2	UTSW	13	21983353	missense	possibly damaging	0.86
R1603:Pom121l2	UTSW	13	21983344	missense	probably damaging	1.00
R1836:Pom121l2	UTSW	13	21983784	missense	probably benign	0.03
R1970:Pom121l2	UTSW	13	21983472	missense	probably damaging	0.98
R2018:Pom121l2	UTSW	13	21982734	missense	possibly damaging	0.54
R2180:Pom121l2	UTSW	13	21981975	missense	probably benign	0.08
R2277:Pom121l2	UTSW	13	21984247	missense	probably benign
R2365:Pom121l2	UTSW	13	21983784	missense	probably benign	0.20
R3951:Pom121l2	UTSW	13	21982128	missense	probably damaging	1.00
R4371:Pom121l2	UTSW	13	21982239	missense	probably benign	0.01
R4574:Pom121l2	UTSW	13	21984402	missense	probably benign	0.02
R4593:Pom121l2	UTSW	13	21984453	missense	probably damaging	1.00
R4983:Pom121l2	UTSW	13	21983814	missense	probably benign	0.02
R5320:Pom121l2	UTSW	13	21981845	nonsense	probably null
R5661:Pom121l2	UTSW	13	21984255	missense	possibly damaging	0.90
R5662:Pom121l2	UTSW	13	21982188	missense	probably benign	0.01
R5908:Pom121l2	UTSW	13	21981814	missense	probably damaging	0.99
R5980:Pom121l2	UTSW	13	21983376	missense	probably damaging	0.96
R6145:Pom121l2	UTSW	13	21982302	nonsense	probably null
R6160:Pom121l2	UTSW	13	21983668	missense	possibly damaging	0.52
R6327:Pom121l2	UTSW	13	21982332	missense	probably damaging	1.00
R6504:Pom121l2	UTSW	13	21983461	missense	possibly damaging	0.55
R6745:Pom121l2	UTSW	13	21983698	missense	probably benign	0.00
R6750:Pom121l2	UTSW	13	21981937	missense	probably damaging	1.00
R6752:Pom121l2	UTSW	13	21981769	missense	probably damaging	0.99
R6796:Pom121l2	UTSW	13	21983524	missense	probably benign	0.09
R6984:Pom121l2	UTSW	13	21982021	missense	probably benign	0.33
R7284:Pom121l2	UTSW	13	21982605	missense	probably damaging	1.00
R7287:Pom121l2	UTSW	13	21984332	missense	probably benign	0.16
R7568:Pom121l2	UTSW	13	21982626	missense	probably benign	0.03
R7624:Pom121l2	UTSW	13	21983529	missense	probably damaging	0.97
R7832:Pom121l2	UTSW	13	21983878	missense	possibly damaging	0.49
R7956:Pom121l2	UTSW	13	21983146	missense	probably damaging	1.00
R8103:Pom121l2	UTSW	13	21982374	missense	probably benign	0.00
R8506:Pom121l2	UTSW	13	21983619	missense	probably benign	0.04
Z1177:Pom121l2	UTSW	13	21988486	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCAACATTAGAGGGGCAAGCTG -3'
(R):5'- TCTCCACGGGAAGTACAGATGCAG -3'

Sequencing Primer
(F):5'- AAGCTGTGCCGAGCAAC -3'
(R):5'- TGGAGAATTGGGTTACTCACCAC -3'

Posted On

2014-01-05