Incidental Mutation 'R1119:Pcnp'
ID97800
Institutional Source Beutler Lab
Gene Symbol Pcnp
Ensembl Gene ENSMUSG00000071533
Gene NamePEST proteolytic signal containing nuclear protein
Synonyms1110018D06Rik
MMRRC Submission 039192-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1119 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56007245-56029739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56024391 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 49 (S49P)
Ref Sequence ENSEMBL: ENSMUSP00000093720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096021] [ENSMUST00000114444] [ENSMUST00000119981] [ENSMUST00000122253] [ENSMUST00000125040] [ENSMUST00000130818]
Predicted Effect probably damaging
Transcript: ENSMUST00000096021
AA Change: S49P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093720
Gene: ENSMUSG00000071533
AA Change: S49P

DomainStartEndE-ValueType
Pfam:PCNP 33 182 4.4e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114444
AA Change: S38P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110087
Gene: ENSMUSG00000071533
AA Change: S38P

DomainStartEndE-ValueType
Pfam:PCNP 22 171 4.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119981
SMART Domains Protein: ENSMUSP00000112565
Gene: ENSMUSG00000071533

DomainStartEndE-ValueType
Pfam:PCNP 1 100 6.3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122253
AA Change: S38P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113605
Gene: ENSMUSG00000071533
AA Change: S38P

DomainStartEndE-ValueType
Pfam:PCNP 22 139 3.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125040
Predicted Effect probably benign
Transcript: ENSMUST00000130818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140227
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,987,045 V2524G probably damaging Het
Adamtsl3 A C 7: 82,540,317 E583A probably damaging Het
Aoah T A 13: 20,914,938 probably benign Het
Atf7ip2 A G 16: 10,240,612 K305R possibly damaging Het
Ccdc129 T C 6: 55,889,170 F183L probably damaging Het
Cd200r2 A G 16: 44,909,606 N171S probably damaging Het
Cfap57 G A 4: 118,606,676 Q327* probably null Het
Ckap2l A T 2: 129,272,572 probably benign Het
Cul2 A G 18: 3,419,335 probably benign Het
Ddx60 G A 8: 61,942,544 V172M probably damaging Het
Drp2 T C X: 134,441,322 L545P probably damaging Het
Ezh1 A G 11: 101,210,535 probably benign Het
Gipc2 A G 3: 152,094,196 F299S probably damaging Het
Gsk3b T C 16: 38,207,984 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hikeshi A G 7: 89,935,730 S89P probably benign Het
Hmcn1 C T 1: 150,618,928 A4137T possibly damaging Het
Larp1b C A 3: 41,033,528 R62S possibly damaging Het
Lgr5 A T 10: 115,460,811 probably null Het
Lpin1 C A 12: 16,563,721 D449Y probably damaging Het
Macrod2 A T 2: 140,400,906 I31L probably benign Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Ndufa9 A T 6: 126,822,068 L362Q probably damaging Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nxpe5 G A 5: 138,239,396 D61N probably benign Het
Ogdh T A 11: 6,340,544 H376Q probably damaging Het
P4ha3 T C 7: 100,313,328 I431T probably damaging Het
Pcdhb14 G A 18: 37,448,587 V249M probably damaging Het
Pik3r6 C T 11: 68,545,872 T654I probably benign Het
Rptn A G 3: 93,396,245 Y295C possibly damaging Het
Sec16b A G 1: 157,564,834 D924G possibly damaging Het
Setd1b C A 5: 123,147,716 T275K unknown Het
Sgcb T A 5: 73,644,414 K36I probably damaging Het
Smg7 A T 1: 152,866,575 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stab2 T C 10: 86,859,755 D599G possibly damaging Het
Stk36 A G 1: 74,632,766 E875G probably benign Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tax1bp1 C A 6: 52,741,948 probably benign Het
Thnsl1 A G 2: 21,213,046 N16S probably damaging Het
Ticrr C T 7: 79,693,953 P1189S probably benign Het
Tnxb G A 17: 34,685,043 V1053M probably damaging Het
Tpp2 T C 1: 43,992,396 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Vmn2r60 A T 7: 42,194,941 Q576L possibly damaging Het
Zfp62 G T 11: 49,216,690 R536L probably damaging Het
Zfp958 A T 8: 4,626,169 N46Y possibly damaging Het
Other mutations in Pcnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0196:Pcnp UTSW 16 56024533 utr 3 prime probably benign
R1118:Pcnp UTSW 16 56024391 missense probably damaging 1.00
R1459:Pcnp UTSW 16 56024340 missense possibly damaging 0.84
R1878:Pcnp UTSW 16 56018487 missense probably damaging 1.00
R4774:Pcnp UTSW 16 56017159 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CTCACACTTGCTCCGAGTCTAATGG -3'
(R):5'- TGTACTGCCACACAATCTCAGTTCC -3'

Sequencing Primer
(F):5'- CTCCGAGTCTAATGGAGATGGC -3'
(R):5'- TGCTGTACACTCTAGCAAGC -3'
Posted On2014-01-05